Go to the U of M home page

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Gene Information: Y74C10AL.2

    NameY74C10AL.2 View on WormBase
    Species C. elegans
    SequenceY74C10AL.2
    Genetic positionI:-8.57 +/- 0.000 cM
    Genomic positionI: 2468793..2471935

    Strains carrying this gene

    • «
    • 1
    Strain Genotype Description
    TOG3 Y74C10AL.2(ogr3) I. Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CeNDR - the C. elegans Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics