Gene Information: T09F3.2

NameT09F3.2 View on WormBase
Species C. elegans
SequenceT09F3.2
Genetic positionII:2.55 +/- 0.000 cM
Genomic positionII: 10391154..10393614

Strains carrying this gene

Strain Genotype Description
BC15419 dpy-5(e907) I; sEx15419. sEx15419 [rCes T09F3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
TOG2 T09F3.2(ogr2) II. Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt