Gene Information: T09F3.2
| Name | T09F3.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T09F3.2 |
| Genetic position | II:2.55 +/- 0.000 cM |
| Genomic position | II: 10391154..10393614 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| BC15419 | dpy-5(e907) I; sEx15419. | sEx15419 [rCes T09F3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
| TOG2 | T09F3.2(ogr2) II. | Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt |