Laboratory Information
| Name | TH View on WormBase |
|---|---|
| Allele designation | dd |
| Head | Tony Arie Hyman |
| Institution | Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany |
| Address | MPI-CBG Pfotenhauerstrasse 108 Dresden 01307 Germany |
| Website | http://hymanlab.mpi-cbg.de/hyman_lab/ |
| Gene classes | bub cls dcd gip knl lgl ndc rsa tpxl |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| TH11 | unc-5(e53) dpy-20(e1282) IV. | C. elegans | Unc. ts Dpy. |
| TH112 | let-99(dd17) IV/nT1 [qIs51] (IV;V). | C. elegans | let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation. |
| TH113 | let-99(dd18) IV/nT1 [qIs51] (IV;V). | C. elegans | let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation. |
| TH175 | unc-119(ed3)III; ddIs97. | C. elegans | ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH189 | unc-119(ed3)III; ddIs106. | C. elegans | ddIs106 [hmg-3::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH205 | unc-119(ed3) III; ddEx120. | C. elegans | ddEx120 [cpar-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH215 | unc-119(ed3)III; ddIs129. | C. elegans | ddIs129 [klp-4::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH237 | unc-119(ed3) III; ddEx291. | C. elegans | ddEx291 [his-24::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH322 | unc-13(e51) rsa-1(dd10) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27. |
| TH323 | unc-13(e51) rsa-1(dd13) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27. |
| TH346 | unc-119(ed3)III; ddIs193. | C. elegans | ddIs193 [rabs-5::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH37 | dpy-11(e224) unc-23(e25) V. | C. elegans | Dpy. Unc. |
| TH439 | unc-119(ed3)III; ddIs254. | C. elegans | ddIs254 [ctbp-1::2xTY1::GFP:: FRT::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TH48 | mbk-2(dd5) IV. | C. elegans | Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos. |
| TH65 | unc-119(ed3) III; ddIs15. | C. elegans | ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| dd5 | Allele | substitution | |
| dd17 | Allele | deletion | |
| dd18 | Allele | deletion | |
| dd10 | Allele | substitution | |
| dd13 | Allele | substitution | splice_site |