Gene Information: cha-1

Namecha-1 View on WormBase
Species C. elegans
SequenceZC416.8
Genetic positionIV:-3.12 +/- 0.004 cM
Genomic positionIV: 3613931..3624697

Strains carrying this gene

Strain Genotype Description
DR697 cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Heterozygotes are WT and segregate WT, Vul and Lethals.
MT3516 lin-1(e1275) cha-1(p1152) IV. Temperature sensitive Multi-vulva. Slow growing. Unc-coils, jerky going backward. Small.
MT6205 cha-1(n2411) IV. Coiler.
PJ1046 cha-1(p1182) IV; ccIs55 V. ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc lethal at 25C. Difficult to score <25C.
PJ1055 cha-1(p1182) IV; unc-68(r1162) ccIs55 V. ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow movement at 25C; might not curl like cha-1 typically does. Very slow movement at 20C. unc-68 channel null.
PJ1164 cha-1(p1182) IV; ccIs55 V; jIs1. ccIs55 [unc-54::lacZ + sup-7(st5)] V. jIs1 [myo-3::GFP + rol-6(su1006)]. jIs1 likely maps to LGI, LGII, or LGX. Rollers; not all animals roll well.
PR1152 cha-1(p1152) IV. Structural gene for choline acetyltransferase (ChAT). Slow growing. Unc-coils, jerky going backward. Small. Resistant to aldicarb and trichlorfon. 99% reduced choline acetyltransferase. Complex complementation pattern with unc-17.
PR1158 cha-1(b401) IV. Temperature sensitive. Unc-difficulty in crawling backwards. Behavior phenotype more pronounced at 25C than at 16C or 20C. Trichlorfon resistant. This strain replaced strain DH401 because Mike Nonet tested DH401 and found it didn't contain cha-1, but did have an unc-11 mutation (5/97).
PR1162 cha-1(p503) IV. Mild (leaky) allele of cha-1. Has approximately 10% WT ChAT activity. Behaviorally normal-normal growth and development. Males mate. Sensitive to cholinesterase inhibitor aldicarb.
RM1743 cha-1(md39) cho-1(tm373) IV. Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, lethal. References: Rand JB. Genetics. 1989 May;122(1):73-80. Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM777 cha-1(md39) IV. Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80.
TN101 cha-1(cn101) IV.
TY1652 cha-1(y226) IV. Temperature sensitive. Wild type at 15C; lethal at 22.5C.
VC1836 cha-1(ok2253) IV/nT1 [qIs51] (IV;V). ZC416.8b. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2253 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACTGACACGCCAATTTTT. External right primer: TGCAATGGCCAAAATGACTA. Internal left primer: CGAGCTCATCGAAAACTTCC. Internal right primer: CCCAAGCCTAAGCCTAAACC. Internal WT amplicon: 2862 bp. Deletion size: 1712 bp. Deletion left flank: ACCGTATATCTACAGTACCCCTACATCACT. Deletion right flank: TGCAAAATATTTCTGTGAGAGGTAATTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807