Gene Information: unc-17

Nameunc-17 View on WormBase
Species C. elegans
SequenceZC416.8
Genetic positionIV:-3.11 +/- 0.009 cM
Genomic positionIV: 3618259..3624699

Strains carrying this gene

Strain Genotype Description
AG166 mdf-2(av16) unc-17(e245) IV. Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C.
CB113 unc-17(e113) IV. Unc, coiler. Lannate sensitive.
CB1893 unc-17(e113) dpy-13(e184) IV. DpyUnc. e184 is semi-dominant.
CB2110 unc-17(e245) IV; sup-2(e997) X. Suppressed Unc. Movement almost WT.
CB3031 unc-17(e245) IV; snb-1(e1563) V. Dominant suppressor of Unc. Movement almost WT.
CB3249 unc-17(e245)/dpy-26(n199) IV. Heterozygotes are WT and segregate WT, Unc and Dpyish. Dpyish hermaphrodites segregate severe Dpy (often lethal) and non-Dpy males.
CB5265 sup-1(e995e2636) III; unc-17(e245) IV; xol-1(y9) X. Severely uncoordinated coiler, slow growing. Useful strain for selecting non-Sup-1 suppressors of unc-17(e245). Reference: Mathews et al. (2012) PMID: 23051648.
CB7427 unc-17(e245) IV; eEx849. eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
CB7430 unc-17(e245) IV; eEx855. eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
CB933 unc-17(e245) IV. M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.
DR105 unc-17(e245) dpy-20(e1282) IV. DpyUnc.
DR1786 dpy-13(e184) unc-24(e138) IV; mDp4[unc-17(e245)] (IV;?). WT phenotype. Segregates WT and DpyUncs. mDp4 carries dpy-13(+) and unc-24(+). Duplication may recombine with normal homologues. Presence of unc-17(e245) on mDp4 confirmed: got Unc-17 segregants after heat shock of this stock to generate males. Pick WT and check for segregation of progeny to maintain.
DR690 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-272(m243) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.
DR691 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-287(m244) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.
DR692 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-275(m245) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR694 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-281(m247) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR695 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-285(m248) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.
DR703 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-274(m256) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.
DR705 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-282(m258) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR706 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-280(m259) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR709 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-279(m261) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR710 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-277(m262) IV. Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR711 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-273(m263) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR715 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-284(m267) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR717 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-286(m269) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.
DR767 unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-288(m306) IV. Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR907 unc-17(e113) dpy-13(e184) IV; mDp1 (IV;f). Animals which carry the Dup are semi-Dpy and segregate semi-Dpy and DpyUnc (animals which have lost the Dup). Animals homozygous for the Dup are slow growing, slender and transparent. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
EM141 unc-17(e113) col-34(bx25) IV; him-5(e1490) V. Unc. Abnormal rays. bx25 previously called ram-4.
KW1973 taf-6.2(ax701) unc-17(e113) IV. Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).
KW1975 taf-6.2(ax514) unc-17(e113) IV. Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).
LX929 vsIs48. vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons.
MT4150 unc-17(e245) dpy-4(e1166) IV; him-5(e1490) V. DpyUnc. Segregates males.
MT628 dpy-9(e12) unc-17(e245) IV. Dpy. Unc.
OH15568 unc-17(ot907[unc-17::mKate2::3xflag]) IV. Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
RM3643 sup-1(e995 e2636) III; unc-17(e245) IV. Indistinguishable from unc-17(e245) single mutants (small, slow-growing, coily uncoordinated, jerky going backward, aldicarb-resistant). For additional information, see descriptions of the RM908 unc-17(e245) IV and RM3671 sup-1(e995 e2636)) III single mutant strains. PCR methods for scoring e245, e995, and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Derived by crossing RM908 (6x outcrossed) and RM3571 (6x outcrossed). Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM3645 unc-17(e245) IV; snb-1(e1563) V. Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3659 snb-1(e1563) V single mutant strains. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.
RM3660 sup-1(e995) III; unc-17(e245) IV. Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3670 sup-1(e995) III single mutant strains. PCR methods for scoring e245 and e995 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM523 unc-17(cn355) IV. cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
RM580 unc-17(md1447) IV. md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM908 unc-17(e245) IV. Small, slow-growing, coily uncoordinated, jerky going backward, aldicarb- and lannate-resistant. Molecular details: G347R (gga>>aga) in the 9th transmembrane domain of the UNC-17 protein. PCR method for scoring the e245 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012.
RM969 smg-1(md7) I; unc-17(md1447) IV. Approximately wild-type for the unc-17 phenotypes; displays typical smg-1 phenotypes (protruding vulvae, defective male tails, poor male mating).
XA4828 unc-13(e1091) I; unc-17(e327) IV. Previously called MA1128.