Gene Information: erh-1
| Name | erh-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T21C9.4 |
| Genetic position | V:2.60 +/- 0.000 cM |
| Genomic position | V: 10578427..10579141 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3132 | erh-1(ve632[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | homozygous viable. Deletion of 566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggaaagagatagaagtgagaaacccatatg ; Right flanking sequence: tttggtgttcgggcaatttttatttttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |