Gene Information: dmsr-5

Namedmsr-5 View on WormBase
Species C. elegans
SequenceY48A6B.1
Genetic positionIII:5.82 +/- 0.000 cM
Genomic positionIII: 10992044..10995256

Strains carrying this gene

Strain Genotype Description
PS8888 dmsr-5(sy1557) III. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTG Right flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616