Gene Information: nlp-11

Namenlp-11 View on WormBase
Species C. elegans
SequenceZK1320.10
Genetic positionII:1.65 +/- 0.002 cM
Genomic positionII: 9689664..9691939

Strains carrying this gene

Strain Genotype Description
PHX530 nlp-11(syb530) II. Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447