Gene Information: R12G8.1

NameR12G8.1 View on WormBase
Species C. elegans
SequenceR12G8.1
Genetic positionV:13.17 +/- 0.000 cM
Genomic positionV: 17747966..17749243

Strains carrying this gene

Strain Genotype Description
PHX209 R12G8.1(syb209) V. Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.