Variation Information: cc545
Name | cc545 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | I:1.48 +/- 0.010 cM |
Genomic position | genomic coordinates unknown or not listed |
Protein change | protein change unknown or not listed |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
PD8117 | smg-1(cc545) unc-54(r293) I. | C. elegans | Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |
PD8119 | smg-1(cc545) I. | C. elegans | Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |