Variation Information: r293

Namer293 View on WormBase
Species C. elegans
Genetic positionI:27.96 +/- 0.000 cM
Genomic positionI: 14855889..14856142
Protein changeF11C3.3 Deletion

Strains carrying this variation

Strain Genotype Species Description
CZ3086 kin-1(ok338)/unc-54(r293) I. C. elegans Heterozygotes are WT and segregate WT, Unc, and early larval lethal.
PD8117 smg-1(cc545) unc-54(r293) I. C. elegans Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]
PD8118 smg-1(cc546) unc-54(r293) I. C. elegans Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
TR1324 smg-5(r860) unc-54(r293) I. C. elegans P-Vul.
TR1417 smg-1(r904) unc-54(r293) I. C. elegans P-vul.
TR1421 smg-2(r908) unc-54(r293) I. C. elegans P-Vul.
TR1696 unc-54(r293) I; smg-3(r930) IV. C. elegans P-vul.
TR2192 unc-54(r293) I; smg-4(r1169) V. C. elegans P-vul. WT movement.
TR2230 unc-54(r293) I; smg-7(r1197) IV. C. elegans P-Vul. WT movement.
TR2264 unc-54(r293) I; smg-6(r1217) III. C. elegans P-Vul. WT movement.