Laboratory Information
| Name | NH View on WormBase |
|---|---|
| Allele designation | ay |
| Head | Stern, Michael |
| Institution | Northeastern Illinois University, Chicago, IL |
| Address | Northeastern Illinois University CGSR, LWH 0041 5500 N. St. Louis Ave. Chicago 60625-4699 United States |
| Website | https://www.neiu.edu/academics/college-of-arts-and-sciences/departments/biology/faculty-and-staff |
| Gene classes | soc |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MT3184 | sem-4(n1378) unc-13(e51) I. | C. elegans | Unc. Egl. Transformation of sex myoblasts into body wall muscle. |
| MT3188 | egl-17(n1377) X. | C. elegans | Egg-laying defective. Moderate to severe bloating. 30% make bags of worms. Males mate. |
| MT3213 | dpy-5(e61) sem-4(n1378) I. | C. elegans | Dpy. Egl. Transformation of sex myoblasts into body wall muscle. |
| MT3433 | egl-15(n1458) X. | C. elegans | Egl. Maintain under normal conditions. Reference: DeVore DL, et al. Cell. 1995 Nov 17;83(4):611-20. |
| MT3456 | egl-15(n1477) X. | C. elegans | Temperature sensitive Egl. |
| MT3458 | egl-15(n1457) X. | C. elegans | Egl. Maintain under normal conditions. Reference: DeVore DL, et al. Cell. 1995 Nov 17;83(4):611-20. |
| MT3460 | +/szT1 I; dpy-6(e14) egl-15(n1454)/szT1 [lon-2(e678)] X. | C. elegans | WT strain which segregates WT, Dpy L1 lethals, Lon males and dead eggs. Class II egl-15 mutation. |
| MT3858 | sem-3(n1655) IV. | C. elegans | Egl. |
| MT3870 | clr-1(e1745) II; egl-15(n1477) X. | C. elegans | Egl. Temperature sensitive Scrawny-cannot be maintained at 25C. Class III egl-15 mutation. |
| MT3989 | clr-1(e1745) bli-2(e768) II. | C. elegans | Adult Blistered, especially in the head. Starved translucent appearance at 20c; inviable at 25C. |
| MT4030 | clr-1(e1745) II; soc-2(n1774) IV. | C. elegans | clr-1 suppressed. |
| MT4035 | clr-1(e1745) II; sem-5(n1779) X. | C. elegans | About 11% of the animals should be Vulvaless. n1779 suppresses clr-1. |
| MT4039 | clr-1(e1745) II; egl-15(n1783) X. | C. elegans | non-Egl. non-Scrawny. Class IV egl-15 mutation. |
| MT4045 | clr-1(e1745) II; soc-1(n1789) V. | C. elegans | clr-1 suppressed. |
| MT4185 | sem-5(n1779) X. | C. elegans | |
| MT4732 | clr-1(n1992) II; egl-15(n1477) X. | C. elegans | Non-Scr, non-Clr. Egl. |
| MT5104 | lin-31(n301) clr-1(e1745) dpy-10(e128) II. | C. elegans | Dpy. Muv. Starved translucent appearance at 20c; inviable at 25C. |
| MT5267 | soc-1(n1789) V. | C. elegans | WT. Suppresses clr-1. |
| MT5554 | clr-1(e1745) II; egl-15(n2202) X. | C. elegans | Soc. Maintain under normal conditions. Reference: DeVore DL, Development. 2003 Aug;130(16):3757-66. |
| MT5562 | clr-1(e1745) II; egl-15(n2210) X. | C. elegans | Soc. Maintain under normal conditions. Reference: DeVore DL, Development. 2003 Aug;130(16):3757-66. |
| NH2020 | clr-1(e1745) II; sem-5(n1619) X. | C. elegans | Vulvaless. About 91% of the animals die as L1 or early L2. n1619 suppresses clr-1. |
| NH2038 | clr-1(e2530) II; egl-15(n1477) X. | C. elegans | Non-Scr, non-Clr. Egl. |
| NH2044 | egl-15(ay1) X. | C. elegans | Egl. Maintain under normal conditions. Reference: Chen EB, et al. Dev Biol. 1997 Feb 1;182(1):88-100. |
| NH2103 | egl-17(ay6) X. | C. elegans | Egg-laying defective. Null allele. Maintain under normal conditions. Reference: Burdine RD, et al. (1997) PNAS 94(6):2433-7. |
| NH2106 | ceh-20(ay9) III. | C. elegans | Egl (Vul). 90% penetrant. lesion: M78I. |
| NH2192 | egl-17(ay8) X. | C. elegans | Egg-laying defective. Null allele. Maintain under normal conditions. Reference: Burdine RD, et al. (1997) PNAS 94(6):2433-7. |
| NH2267 | let-60(n1046) IV; egl-15(n1454) X. | C. elegans | Unc and scrawny, but viable. Egl. Class II egl-15 mutation. Lethality suppressed by let-60. |
| NH2296 | ceh-20(ay42) unc-36(e251)/sma-3(e491) unc-36(e251) III. | C. elegans | Heterozygotes are Unc and segregate Unc, SmaUnc and UncVul. ay42 is a strong Vul and is recessive. ay42 has slow growth. |
| NH2466 | ayIs4 I; dpy-20(e1282) IV. | C. elegans | ayIs4 [egl-17p::GFP + dpy-20(+)] IV. |
| NH2531 | let-60(ay75)/dpy-20(e1362) IV. | C. elegans | ay75gf: ts dominant Clr, Sterile; Dominant sterile at 25C, fertile at 15C, severely reduced fertility at 20C. At 15C, ay75gf: recessive adults Clr, partially penetrant Muv. At 15C, heterozygotes segregate 50% WT, 25% Dpy, and 25% adult Clear. |
| NH2552 | ceh-20(ay38) unc-36(e251)/sma-3(e491) unc-36(e251) III. | C. elegans | Heterozygotes are Unc and segregate Unc, SmaUnc and larval lethals. Putative null allele. |
| NH2693 | +/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X. | C. elegans | Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP). |
| NH3027 | ncl-1(e1865) III; egl-15(n1456) X; ayEx86. | C. elegans | ayEx86 [col-19::GFP + egl-15(+) (NH#112) + ncl-1(+)(c33c3)]. Maintain by picking non-Egl. Referene: Lo TW, et al. Dev Biol. 2008 Jun 15;318(2):268-75. |
| NH3119 | F54A5.3a(ok198) I. | C. elegans | No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| ay38 | Allele | substitution | nonsense |
| ay1 | Allele | substitution | |
| ay6 | Allele | deletion | |
| ay9 | Allele | substitution | |
| ay8 | Allele | substitution | nonsense |
| ay42 | Allele | substitution | |
| ay75 | Allele | substitution |