Laboratory Information

NameMX View on WormBase
Allele designationnx
HeadLeroux, Michel
InstitutionSimon Fraser University
Address Simon Fraser University
Dept Molecular Biology and Biochemistry
8888 University Drive
Burnaby V5A 1S6
Canada
Website http://www.sfu.ca/~leroux/index.htm
Gene classes bbs  coel  dyf  hdac  ifta  jbts  mks  mksr  pfd  rpi  gasr  bgnt  cfap  efhc 
pcrg 

Strains contributed by this laboratory

Strain Genotype Species Description
MX124 ifta-1(nx61) X. C. elegans Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.
MX52 bbs-8(nx77) V. C. elegans Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed.
ZM8230 ubr-1(hp684) I. C. elegans hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
nx61 Allele deletion
nx77 Allele deletion