Laboratory Information
| Name | MX View on WormBase |
|---|---|
| Allele designation | nx |
| Head | Leroux, Michel |
| Institution | Simon Fraser University |
| Address | Simon Fraser University Dept Molecular Biology and Biochemistry 8888 University Drive Burnaby V5A 1S6 Canada |
| Website | http://www.sfu.ca/~leroux/index.htm |
| Gene classes | bbs coel dyf hdac ifta jbts mks mksr pfd rpi gasr bgnt cfap efhc pcrg |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MX124 | ifta-1(nx61) X. | C. elegans | Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA. |
| MX52 | bbs-8(nx77) V. | C. elegans | Displays Dyf, Che and Odr phenotypes. nx77 is a double deletion in bbs-8. Nucleotides 612-759 and 826-1631 of bbs-8 (numbers refer to unspliced gene sequence) are removed. |
| ZM8230 | ubr-1(hp684) I. | C. elegans | hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| nx61 | Allele | deletion | |
| nx77 | Allele | deletion |