Caenorhabditis Genetics Center (CGC)

Laboratory Information

NameMT View on WormBase
Allele designationn
HeadH. Robert Horvitz
InstitutionMIT, Cambridge MA, USA
Address 77 Mass, Ave.,
68-447
Cambridge 02139
United States
Website http://web.mit.edu/horvitz/www/horvitzlab.html
Gene classes adc  ces  chaf  cpn  crh  dig  dpl  efl  egl  epc  isw  lntl  mbtr  mcd 
met  mfap  mod  muc  mys  nurf  pyp  sem  sho  sqv  ssl  suv  tbh  tdc  tos 
trr  vesa  smcr 

Strains contributed by this laboratory

Strain Genotype Species Description
CB1313 egl-17(e1313) X. C. elegans Egg-laying defective. Moderate to severe bloating. 30% make bags of worms. Males mate. [NOTE: Probably contains a tightly linked mutation which cannot be crossed off. Use MT3188 as reference strain. Michael Stern 6\97]
CB1322 lin-8(n111) II; lin-9(n112) III. C. elegans Multivulva.
CB1439 lin-10(e1439) I. C. elegans Vulvaless.
CB1449 lin-7(e1449) II. C. elegans Vul.
CB1507 unc-86(e1507) III. C. elegans HSN-. Egl. Mec.
CB1893 unc-17(e113) dpy-13(e184) IV. C. elegans DpyUnc. e184 is semi-dominant.
CB2238 lon-2(e678) unc-84(e1410) X. C. elegans Lon. Unc.
CB2261 dpy-5(e61) unc-40(e1430) I. C. elegans DpyUnc.
CB2338 mab-6(e1249) II; him-5(e1490) V. C. elegans Segregates males. Males abnormal.
CB2771 eDf5/eDf24 I. C. elegans Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
CB3060 sup-9(n180) II; unc-93(e1500) III. C. elegans Recessive Suppressor. XO Fertile hermaphrodite. WT phenotype.
CB3387 ced-1(e1735) I; ced-2(e1752) IV. C. elegans
CB4711 mab-5(e1239) egl-5(n945) III. C. elegans n945: HSN-. Egl. Coiler.
JK1122 dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and DpySteriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JT5218 sup-17(sa38) I; lin-12(n302) III. C. elegans sa38 is a weak Egl and a moderate suppressor of lin-12(gf).
JT5222 sup-19(sa45) I; lin-12(n302) III. C. elegans sa45 is a weak Egl and a moderate suppressor of lin-12(gf).
JT94 unc-25(sa94) III. C. elegans Temperature sensitive. Weak allele.
MT1000 unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 V. C. elegans Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT.
MT1001 lin-1(e1777) IV. C. elegans Multivulva. Amber. No male mating. Not Null.
MT1006 lin-1(n431) IV. C. elegans Strong Muv.
MT1007 lin-24(n432) IV. C. elegans Semi-dominant. Adult hermaphrodite Vul.
MT1035 lin-12(n137n460) III. C. elegans WT at 25C. Muv and Egl at 15C.
MT10408 lin-53(n833) I; unc-76(e911) V; lin-15A(n767) X; nEx998. C. elegans nEx998 [lin-53::GFP + unc-76(+)]. Pick non-Unc, non-Muv to maintain.
MT10430 lin-35(n745) I. C. elegans synMuv with n111.
MT105 lin-2(n105) X. C. elegans Temperature sensitive vulvaless. Penetrance: 24% at 15C, 90% at 25C.
MT10549 tdc-1(n3421) II. C. elegans Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
MT10591 lin-8(n2731) II. C. elegans SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT106 lin-7(n106) II. C. elegans Egl.
MT10661 tdc-1(n3420) II. C. elegans Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
MT1067 egl-31(n472) I. C. elegans Egg laying defective. Makes bags of worms. Backward Unc.
MT1068 unc-40(n473) I. C. elegans
MT1069 egl-18(n474) IV. C. elegans Egl. Variably Vul.
MT1071 egl-21(n476) IV. C. elegans Egl. Fails to complement daf-14 as well; small deletion or background?? [NOTE: The CGC has received reports that n476 might be heterozygous in this strain. KP2018 is an outcrossed version of this strain and has been confirmed as homozygous for n476.].
MT1072 egl-4(n477) IV. C. elegans Egl. Odr-see 1998 ECWM #71.
MT1073 egl-4(n478) IV. C. elegans Egg laying defective. Retains late stage eggs. Odr-see 1998 ECWM #71.
MT1074 egl-4(n479) IV. C. elegans Temperature sensitive Egl. Odr-see 1998 ECWM #71.
MT1076 egl-26(n481) II. C. elegans Egg laying defective. Makes bags of worms. Abnormal vulva.
MT1077 lin-29(n482) II. C. elegans Egg laying defective. Makes bags of worms. Abnormal vulva. Previously called egl-29.
MT1078 egl-13(n483) X. C. elegans Egg laying defective. Makes bags of worms. Males mate.
MT1079 egl-15(n484) X. C. elegans Egg laying defective. Makes bags of worms. Males mate.
MT1080 sdc-1(n485) X. C. elegans Variable egg laying defective. Abnormal vulva. Males mate.
MT1081 egl-5(n486) III. C. elegans Egl-moderate bloating, uncoordinated coiler phenotype. Males do not mate.
MT1082 egl-1(n487) V. C. elegans Egg-laying defective. Retains late stage eggs. Semi-dominant. Males mate successfully. Egg-laying serotinin sensitive and imipramine resistant.
MT1083 egl-8(n488) V. C. elegans Egg laying defective. Retains late stage eggs.
MT1085 unc-8(n491) IV. C. elegans Coiler Unc. Dominant.
MT1086 unc-8(n492) IV. C. elegans Semi-dominant curly Unc.
MT10869 ced-10(n3417)/lin-1(e1275) dpy-13(e184) IV. C. elegans Heterozygotes are semi-Dpy. Throws DpyLins and DTC-defective progeny.
MT1088 unc-1(n494) X. C. elegans Coiler Unc. Semi-dominant.
MT1089 unc-58(n495) X. C. elegans Dominant Unc. Paralysed.
MT1092 unc-43(n498) IV. C. elegans Gain of function allele. Small, almost paralyized. Egl. Semi-dominant. daf-C at 27C.
MT1093 unc-108(n501) I. C. elegans Dominant Slow.
MT1098 unc-105(n506) II. C. elegans Semi-dominant Unc.
MT10996 sqv-5(n3611)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT and segregate WT, Sqv Mel, and dead eggs.
MT11090 mcd-1(n3376) II; nIs106 X. C. elegans nIs106 [lin-11::GFP + lin-15(+)] X. Egl, Him. lin-11::GFP expressed in vulva, head neurons, VC neurons. n3376 enhances ced-3(n2427). Reference: (2007) Genetics 175(4)::1719-33.
MT111 lin-8(n111) II. C. elegans WT phenotype. Synthetic Muv.
MT11147 dpl-1(n3643) II. C. elegans Animals are Unc.
MT11190 mod-5(n3314) dpy-5(e61) I. C. elegans Dpy. Serotonin hypersensitive. 5-HT hypersensitivity phenotype. Hyperslowing in locomotion assay.
MT112 lin-9(n112) III. C. elegans WT. Synthetic Muv with lin-8 or lin-38.
MT1122 sup-11(n403) I; unc-93(e1500) III. C. elegans Phenotype: small, scrawny, thin, lays few eggs. unc-93(e1500) rubberband phenotype is completely suppressed by sup-11(n403) so only sup-11 phenotype is visible. n403 is semidominant.
MT11318 nIs133 I; ceh-30(n3714) X. C. elegans nIs133 [pkd-2::GFP]. Reference: Schwartz HT & Horvitz HR (2007) Genes Dev 21(23):3181-94.
MT1132 unc-93(e1500) sup-18(n463) III. C. elegans
MT1141 bli-3(n529) I. C. elegans
MT1147 lin-14(n355n534) X. C. elegans Revertant.
MT1153 lin-14(n536n540) X. C. elegans n540 is an intragenic revertant of semi-dominant n536.
MT11713 mep-1(n3702) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, PvlSte, and dead eggs.
MT1175 lin-25(n545) V. C. elegans Temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless.
MT11757 ced-9(n3400)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT. Segregates Dpy Steriles.
MT1179 egl-14(n549) X. C. elegans Egg laying defective. Most progeny released, but released late (lima bean or later). Males mate poorly.
MT11826 sqv-7(n3789)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs, and Sqv which are sterile (probably Mel). The bases 17746 to 19294 of the C52E12 cosmid sequence are deleted and 19295 to 19316 are duplicated. The N terminal 239 bases of coding sequence for sqv-7 are left intact; they are predicted to encode 79 amino acids (of 329 amino acids total) of SQV-7 (followed by a frameshift).
MT11836 ark-1(n3701) IV. C. elegans SynMuv.
MT1196 lin-11(n566) I. C. elegans Egl.
MT1200 egl-28(n570) II. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive.
MT1201 egl-9(n571) V. C. elegans Egl.
MT1202 egl-24(n572) III. C. elegans Egg laying defective. Retains late stage eggs.
MT12024 unc-24(e138) dpy-20(e1282) IV. C. elegans Dpy (ts). Unc (amber).
MT1203 paqr-2(n573) III. C. elegans Egg laying defective. Retains late stage eggs. Forms bags of worms. Tails variably abnormal. CGC rec'd new stock 8/97.
MT1205 egl-7(n575) III. C. elegans Egg laying defective. Retains late stage eggs. Partially temperature sensitive. Semidominant.
MT1206 egl-21(n576) IV. C. elegans Egl. Reference: Genetics (1983) 104:619-47.
MT1207 unc-31(n577) IV. C. elegans Temperature sensitive. pka egl-22.
MT1208 egl-38(n578) mec-3(n3197) IV. C. elegans Egl. Strain contains both a mec mutation and an egl mutation. Touch insensitive. Abnormal vulva. Forms bags of worms.
MT1212 egl-19(n582) IV. C. elegans Egg laying defective. Retains late stage eggs. Slow and Floppy; Long.
MT1215 egl-20(n585) IV. C. elegans Egg laying defective. Retains late stage eggs. partially ts
MT1216 egl-9(n586) V. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive->non or weakly egl at 15C
MT1217 egl-11(n587) V. C. elegans Egg laying defective. Retains late stage eggs. Partially temperature sensitive.
MT1218 egl-3(n588) V. C. elegans Semi-dominant Egl.
MT1219 egl-3(n589) V. C. elegans Egl.
MT1222 egl-6(n592) X. C. elegans Egg laying defective. Retains late stage eggs. Males mate. Weak kinker. Semidominant.
MT1229 egl-12(n599) V. C. elegans Egl.
MT1231 egl-23(n601) IV. C. elegans Egg laying defective. Makes bags of worms. Dominant. Sluggish.
MT1232 egl-12(n602) V. C. elegans Egg laying defective. Retains late stage eggs. Semidominant.
MT12352 trr-1(n3630)/mIn1 [dpy-10(e128) mIs14] II. C. elegans Heterozygotes are WT and GFP+ and segregate WT, Dpy GFP+, and Sterile GFP-. n3630 predicted to cause W2132Amber.
MT1236 egl-40(n606) IV. C. elegans Egg laying defective. Retains late stage eggs. Semidominant. Temperature sensitive-non or weakly Egl at 15C. Males mate.
MT1241 egl-21(n611) IV. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.
MT1242 egl-4(n612) IV. C. elegans Temperature sensitive Egl. Odr-see 1998 ECWM #71.
MT12615 mys-1(n3681) V. C. elegans Reference: Ceol CJ, Horvitz HR. Dev Cell. 2004 Apr;6(4):563-76.
MT12719 lin-61(n3809) I; lin-15A(n767) X. C. elegans Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT12833 lin-61(n3809) I. C. elegans
MT12835 lin-61(n3809) I; lin-56(n2728) II. C. elegans SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT12836 lin-61(n3809) I; lin-38(n751) II. C. elegans SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT12839 lin-61(n3809) I; lin-8(n2731) II. C. elegans SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT12853 her-1(hv1y101) V. C. elegans
MT12881 lin-61(n3447) I; lin-56(n2728) II. C. elegans SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT12945 mir-52(n4100) IV. C. elegans Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12954 mir-1(n4101) I. C. elegans Deletion breakpoints are:TAGAGCATGTTGCCAATATTGGCAT / GAAAATATTGGCAA...TCACTTTGAATATAGCG / TAGATATAGAGTAGAATTGAATCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12955 mir-1(n4102) I. C. elegans Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12958 mir-87(n4104) V. C. elegans Deletion breakpoints are:CACACACACACACACATACATA / CATACATACAT...CACACAGCCAAAA / GGGGCGGGACGACGACTCCTCCCCGCCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12960 epc-1(n4076) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
MT12963 ssl-1(n4077) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
MT12969 mir-259(n4106) V. C. elegans Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12979 mir-70(n4110) V. C. elegans Deletion breakpoints are:TTTTTTACCGTTGAGTTTCAGAAGT / ATATTTTTTCT...ACGACGTATTA / CATTTCTTCATAAGTGTTATTCGTCGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12983 mir-238(n4112) III. C. elegans Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12989 mir-53(n4113) IV. C. elegans Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12990 mir-52(n4114) IV. C. elegans Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12993 mir-71(n4115) I. C. elegans Deletion breakpoints are: CGATCCCGACGGCGAAAAACAG / AATAGTGATACGAC...TGTGTGTGAGCTA / GTTTCAACACTGAGGTTTTGTTGGAAAGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12999 mir-85(n4117) II. C. elegans Deletion breakpoints are:TCATCTGATGACTTATCTTCA / TACTCGTGT...AACGTGATGAA / GGTCCGGATAGGGCTTGAGCTATTCGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13015 mir-72(n4130) II. C. elegans Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13016 nDf52 III. C. elegans nDf52 removes mir-229 and mir-64. Deletion is 652 bp from -525 to 128 from 5'end of mir-64. Reference: PLos Genet (2007) 3(12):e215.
MT13032 sli-1(n3538) X. C. elegans SynMuv.
MT1306 lin-17(n671) I. C. elegans Slightly Unc. Long irregularly shaped tail. May be Egl. Many hermaphrodites (50%) have single small protrusion posterior to vulva, some gonadal abnormality and sterility.
MT1307 lin-11(n672) I. C. elegans Semi-dominant Vul. Never mates.
MT13078 mir-73&mir-74(nDf47) X. C. elegans Deletion breakpoints are: GAGAGTCCCACACACGACTGGACTTCCA / TATCGAGCCA...AATGGCAGTCTA / CACGTTTTTCAACCAAATGCTATGGCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13113 tdc-1(n3419) II. C. elegans n3419 is a deletion in L-aromatic amino acid decarboxylase with homology to histadine decarboxylase. Forages while backing. PKA adc-1.
MT13172 mys-1(n4075) V/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.
MT13231 nDf48 II. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT13232 lin-65(n3441) I. C. elegans
MT1329 lin-12(n302) III; him-5(e1467) V. C. elegans Vulvaless. Segregates males which mate well.
MT13292 mir-124(n4255) IV. C. elegans Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13293 met-2(n4256) III. C. elegans Deletion of R05D3.11.
MT1337 lin-12(n137) III; nT1 (IV;V). C. elegans
MT13372 nDf49 II. C. elegans mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1338 lin-31(n301) II; nT1 (IV;V). C. elegans
MT13406 mir-34(n4276) X. C. elegans Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1341 lin-12(n302) III; nT1 (IV;V). C. elegans Vulvaless.
MT13433 mir-45(n4280) II. C. elegans Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1344 bli-3(e767) lin-17(n677) I. C. elegans
MT1348 dpy-20(e1362) lin-3(e1417) IV. C. elegans Dpy. Vul.
MT1350 lin-8(n111) II; lin-9(n112) unc-86(e1416) III. C. elegans Unc. Muv.
MT13516 isw-1(n4066) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n4066 homozygotes (sterile). n4066 is a deletion of F37A4.8.
MT13544 ceh-30(n4289) X. C. elegans Reference: Schwartz HT & Horvitz HR (2007) Genes Dev 21(23):3181-94.
MT13649 nurf-1(n4295) II. C. elegans 1077 bp deletion of the 3' end of F26H11.3.
MT13653 mir-237(n4296) X. C. elegans Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13664 nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. C. elegans n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
MT1373 lin-13(n387)/unc-32(e189) III; him-5(e1467) V. C. elegans Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.
MT1392 dpy-7(e1324) sma-5(n678) X. C. elegans Dpy (ts) Sma.
MT13949 mir-80(nDf53) III. C. elegans Deletion breakpoints are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / GATTAGGAGAGTATAGACATCGAAAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13952 lgc-53(n4330) X. C. elegans 1.463 kb deletion in T21F2.1 encoding ligand-gated chloride channel. Homozygous viable.
MT13954 mir-81&mir-82(nDf54) X. C. elegans Deletion breakpoints are: AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13971 hpl-1(n4317) X. C. elegans Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.
MT1401 +/szT1 [lon-2(e678)] I; nDf19/szT1 X. C. elegans Hets are WT and throw WT, dead eggs and Lon males. Maintain by picking WT.
MT14091 mir-79(n4126) I. C. elegans Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14117 mir-2(n4108) I; nDf49 II. C. elegans mir-42, mir43 and mir-44 are deleted in nDf49. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14119 nDf50 II. C. elegans Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14128 nDf53 III; nDf54 X. C. elegans Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.
MT14171 met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
MT1422 paqr-2(n573) unc-32(e189) III. C. elegans Egl. Unc.
MT1430 unc-42(e270) egl-9(n586) V. C. elegans Egl Unc. n586 is a temperature sensitive allele.
MT1434 egl-30(n686) I. C. elegans Egg-laying defective. Retains late stage eggs. Semi-dominant. Unc-slow moving.
MT14347 mir-273(n4438) II. C. elegans Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14355 ftt-2(n4426) X. C. elegans Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null.
MT14378 met-2(n4256) III; hpl-1(n4317) X. C. elegans
MT1438 daf-1(n690) IV. C. elegans Egl. Temperature sensitive Daf-C.
MT14390 let-418(n3536) V. C. elegans Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.
MT1440 ced-1(n691) I. C. elegans
MT14401 set-12(n4442) X. C. elegans Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.
MT1442 mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT.
MT1443 egl-10(n692) V. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C. Semidominant. Males mate. Sluggish and weak kinker.
MT1444 egl-2(n693) V. C. elegans Dominant egg laying defective. Makes bags of worms. Males mate poorly.
MT14446 mir-228(n4382) IV. C. elegans Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14448 mir-79(n4126) I; mir-75(n4472) X. C. elegans Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
MT14449 mir-232(nDf56) IV. C. elegans Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1445 egl-35(n694) III. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.
MT14450 mir-51(n4473) IV. C. elegans Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14451 mir-76(n4474) III. C. elegans Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14452 mir-46(n4475) III. C. elegans Deletion breakpoints are:CTATGAATGTTTAAAA / AAAAAAATTTTTTGAAAAGTAAGCAA...AGAGCCCTAAAAGTCTTAACT / GTTCTGCGCAACTTTCGACAACGTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14480 set-11(n4488) II. C. elegans Deletion allele. Reference: Andersen EC, Horvitz HR. Development. 2007 Aug;134(16):2991-9.
MT1449 lin-17(n698) I. C. elegans Egl. n698 is the weakest allele of lin-17.
MT14525 mir-254(n4470) X. C. elegans Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14533 nDf50 nDf49/mIn1 [mIs14 dpy-10(e128)] II. C. elegans Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.
MT14588 mir-234(n4520) II. C. elegans Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1460 egl-17(e1313) lon-2(e678) unc-18(e81) X. C. elegans Egl. Lon. Unc.
MT14615 set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes).
MT14661 mir-265(n4534) IV. C. elegans Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14662 mir-230(n4535) X. C. elegans Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14666 egl-6(n4537) X. C. elegans 2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.
MT14673 mir-359(n4540) X. C. elegans Deletion breakpoints are: TGTTTTATAGAAAGCTGAGGGTGTGTGTGTGTG / CCAGATGG_GTAAGTGAATT / GTTTTGTGTAGATGGTGGAAATGAGCAGGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14678 lgc-40(n4545) X. C. elegans 1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable.
MT14680 lgc-55(n4331) V. C. elegans 1.986 kb deletion in Y113g7A.5 encoding ligand-gated chloride channel. Homozygous viable.
MT14682 mir-257(n4548) V. C. elegans Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14725 sfa-1(n4562) IV/nT1 [qIs51] (IV;V). C. elegans Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
MT14728 mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.
MT14748 nDf51 V; nEx1184. C. elegans nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT14751 nDf50 nDf49 II; nEx1187. C. elegans nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT14752 nDf50 nDf49 II; nEx1188. C. elegans nEx1188 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT14753 nDf50 nDf49 II; nEx1189. C. elegans nEx1189 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT14761 lin-53(n833) I. C. elegans Superficially wild-type. Synthetic Muv with lin-15A(n767).
MT14767 mir-54&mir-55(nDf58) X. C. elegans Deletion breakpoints are: GAATGTTCACTGAGCTCTACATCATTG / TTCAAACAGTTT...AAGTTGTGATCTAC / AATTATCTTTGGATTTTTAATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14768 mir-231(n4571) III. C. elegans Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14778 nDf51 V; nEx1192. C. elegans nEx1192 [sur-5::GFP]. Maintain by picking GFP+. nEx1192 does not rescue the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT1484 lin-18(e620) dpy-7(e1324) X. C. elegans e1324 is a ts allele - animals are Dpy at 25C. Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture.
MT14851 set-2(n4589) III. C. elegans Deletion allele.
MT14875 nDf59 V. C. elegans mir-61 (F55A11.9), mir-250 (F55A11.12) and part of F55A11.3 are deleted in nDf59. Deletion breakpoints are:TGGATTTCCACAACAACCAGCTGGTGCC / GGAGGTGCTCAGCCTGG...GTTCTAGTCATTGCC / ATACGGAGGAAGGACTAAGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14876 mir-261(n4594) II. C. elegans Deletion breakpoints are:TTTTCGAATTGGCTTATG / AACCGATGGCATTTTCTTCTC...TGCAAATTGGGGCCAACA / ATACAATAGGTGTAAAATGGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14878 mir-270(n4595) IV. C. elegans Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14879 nDf48 nDf49 II. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT1488 lin-17(n677) unc-13(e1091) I. C. elegans
MT14910 pyp-1(n4599) IV/nT1 [qIs51] (IV;V). C. elegans n4599: C47E12.4 deletion from AA12F3.
MT14911 set-4(n4600) II. C. elegans C32D5.5 deletion allele.
MT14919 mir-260(n4601) II. C. elegans Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects
MT14935 mir-59(n4604) IV. C. elegans Deletion breakpoints are: GAAATAAGGCTCTACAGT / ATGCTCAGACATAAATTA...ACGGTAGCTCCACGGGCAT / TTTAATGACAACTTACATAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14936 mir-242(n4605) IV. C. elegans Deletion breakpoints are: GTACCTAGACAATATTCCT / CACCAACCTCAATTCAACAC...GGCTTAAGCTTAGGCGAATA / CAATCAATTTTTCAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14937 mir-251(n4606) X. C. elegans Deletion breakpoints are: TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14984 tph-1(n4622) II. C. elegans Egl. Reduced pharyngeal pumping.
MT14993 mir-46(n4475) III; mir-47(gk167) X. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT150 egl-3(n150) V. C. elegans Egg laying defective. Somewhat Uncoordinated-tends to coil. Temperature sensitive allele.
MT15018 mir-360(n4635) X. C. elegans Deletion breakpoints are:ACGTGCTGTAAAAATTTGCGG / ATACCAAGCCTACAGTTGATTT...GGGACTTTGGGCGGCTTA / AAGTGTCACTGGTCTGGACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15019 nDf60 V. C. elegans mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1502 egl-26(n481) unc-4(e120) II. C. elegans Egl. Abnormal vuvla.
MT15020 mir-246(n4636) IV. C. elegans Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15021 mir-78(n4637) IV. C. elegans Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15022 mir-83(n4638) IV. C. elegans Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15023 mir-268(n4639) V. C. elegans Deletion breakpoints are:TTCCAAAAATGAGACTACGT / AGAAAACATATCG...CCACCCTCTTGTTTTTTTTTT / TGCTCTTTTCCACTCCGTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15024 mir-58.1(n4640) IV. C. elegans Deletion breakpoints are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15025 mir-269(n4641) IV. C. elegans Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15062 hpl-2(tm1489) III; hpl-1(n4317) X. C. elegans
MT15080 sup-17(n1306) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15081 sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15082 sup-17(n1318) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15083 sup-17(n1319) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15084 sup-17(n1320) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT151 egl-33(n151) I. C. elegans Egg laying defective. Retains late stage eggs. Forms bags of worms. Temperature sensitive: non or weak Egl at 15C.
MT15107 lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.
MT15109 lin-54(n3423) IV/nT1 [qIs51] (IV;V). C. elegans Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
MT1514 lin-39(n709) III. C. elegans Temperature sensitive Vul. 12% Vul at 15C and 45% Vul at 25C. VC's die. Variably Egl. Variably abnormal vulval divisions. See also WBPaper00001768
MT1520 egl-30(n715) I. C. elegans Egl-forms bags of worms. Semidominant. Paralysed. Grows best at 15C.
MT1521 sma-8(n716)/+ V. C. elegans Hets are round-nosed Small. n716 is dominant Small, recessive lethal. To maintain strain pick blunt-nosed animals. May have to remove WT progeny to prevent them from taking over.
MT1522 ced-3(n717) IV. C. elegans Abnormal cell death. Cells that normally die survive.
MT15312 nDf62 X. C. elegans mir-239a and mir-239b are deleted in nDf62. Deletion breakpoints are:GAGTTTTTAACAGTTTCG / CCACTGGCGCTACTC...AATTGTCGACCAAAAAAAT / CTTGCTATAGTTAAATATTCAATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1537 lin-28(n719) I; lin-14(n536) X. C. elegans
MT1538 lin-28(n719) I; lin-4(e912) II. C. elegans
MT1540 egl-36(n728) X. C. elegans Egg laying defective. Makes bags of worms. Dominant.
MT1541 egl-3(n729) V. C. elegans Egl. Unc.
MT1542 unc-16(n730) III. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C. Sluggish; weak coiler. Previously called egl-39.
MT1543 egl-37(n742) II. C. elegans Egg laying defective. Retains late stage eggs. Temperature sensitive.
MT15434 tph-1(mg280) II. C. elegans Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.
MT15454 mir-243(n4759) IV. C. elegans Deletion breakpoints are:CAGAGATCGTGTGACAAT / GACGTTGACGCGAAGAAG.... GAGTAGTGTAATTTCCAATTTTTAT / AGATTAATTCAGGGGTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT155 egl-32(n155) I. C. elegans Egg laying defective. Retains late stage eggs. Forms bags of worms. Partially temperature sensitive. Males mate.
MT15501 mir-83(n4638) IV. C. elegans Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15517 mir-233(n4761) X. C. elegans Deletion breakpoints are:TTGAAGTTGCTCCGGACAAAAA / GCAGCCATCAGTCT...TCTCTCCAAGGTTGTA / ACAGGAGACGACGACCACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15537 unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. C. elegans Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
MT15563 nDf53 III; mir-58.1(n4640) IV; nDf54 X. C. elegans Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT156 lin-26(n156) II. C. elegans Vulvaless. Egg laying defective.
MT15606 met-2(n4256) hpl-2(tm1489) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have lin-15A(n767) in background.
MT15620 cat-2(n4547) II. C. elegans 1,010 bp deletion in cat-2. Reference: Omura D, et al. (2012) PLoS One. 2012;7(6):e38649.
MT15643 mbtr-1(n4775) I. C. elegans WT phenotype. From Horvitz 2002 deletion library; deletion removes exons 4, 5, and 6 causing a frame shift after amino acid 165. This should remove last three MBT repeats. Y48G1A.6.
MT1565 egl-17(e1313) lon-2(e678) X. C. elegans Long. Egl.
MT15695 nIs175 IV; ceh-34(4796) V. C. elegans nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. Extra GFP+ M4 observed in nIs175. Reference: Takashi H, et al. PNAS 2010 Aug 31;107(35):15479-84.
MT1570 dpy-13(e184) egl-18(n475) IV. C. elegans Dpy. Egl. Variably Vul.
MT15767 mir-258.2(n4797) X. C. elegans Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15795 isw-1(n3294) III. C. elegans Wild type vulva; semi-sterile. Suppressor of lin-53(n833) and lin-15(n767).
MT1580 dpy-10(e128) unc-53(n569) II. C. elegans Dpy. Egl.
MT1584 unc-8(e49) egl-19(n582) IV. C. elegans Unc. Egl.
MT15873 mir-240(n4541) X. C. elegans Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15883 csp-2(n4871) IV. C elegans n4871 is a 1136 bp deletion that removes the last five exons, including the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT15884 csp-3(n4872) I. C elegans n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT15894 vps-50(n4022) III. C elegans vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874.
MT1590 egl-11(n587) unc-42(e270) V. C. elegans Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.
MT1593 egl-23(n601) dpy-4(e1166) IV. C. elegans n601 is dominant: Egl, sluggish. e1166 is semidominant.
MT15933 flp-17(n4894) IV. C. elegans Weak suppressor of egl-6(n592). 945 bp deletion. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008, 11(10):1168-76.
MT15981 mir-87(n4104) V; mir-233(n4761) X. C. elegans Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15982 mir-67(n4899) III. C. elegans Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1600 unc-8(e49) egl-21(n611) IV. C. elegans Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.
MT16012 isw-1(n3297) III. C. elegans Wild-type vulva. Semi-sterile. Suppressor of lin-53(n833); lin-15(n767).
MT16033 mir-244(n4367) I. C. elegans Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16060 nDf64 V. C. elegans mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16061 mir-238(n4112) III; nDf62 X. C. elegans 4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73.
MT16133 set-24(n4909) II. C. elegans Reference: Development 134(16):2991-9 (2007).
MT162 egl-18(n162) IV. C. elegans Egg laying defective. Retains late stage eggs. Vulva abnormalities.
MT16231 nIs177 sptf-3(n4850) I. C. elegans nIs177 [ceh-28p::4NLS::GFP + lin-15(+)]. Extra ceh-28p::4NLS::GFP-expressing M4 seen in nIs177 (~30% penetrance). Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT1624 lin-35(n745) I; lin-8(n111) II. C. elegans Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.
MT1628 lin-9(n112) III; lin-15A(n749) X. C. elegans Synthetic Muv. n749 is lin-15 Class A allele.
MT1630 lin-38(n751) II; lin-9(n112) III. C. elegans Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.
MT16308 mir-252(n4570) II. C. elegans Deletion breakpoints are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16309 mir-247&mir-797(n4505) X. C. elegans Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16310 mir-269(n4641) IV. C. elegans Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16311 mir-77(n4286) II. C. elegans Deletion breakpoints are:CTACAAAAACTATTCCATTC / AAAAAACGGCTGTCAGTGC...AGAGACGATTTGTGTCGA / TTTACGAAATTTTCCTCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16316 mir-355(n4618) II. C. elegans Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16317 mir-252(n4570) II; mir-251(n4606) X. C. elegans Deletion breakpoints for n4606 are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Deletion breakpoints for n4570 are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16335 mir-251(n4606) X. C. elegans Deletion breakpoints are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16336 mir-86(n4607) III. C. elegans Deletion breakpoints are:TCTACCGAACTTCGCATAAT / TTCCAATTTTCAATTTCCA...ACAATTTGAAAATAAAAA / TTTGCAGAAAAAGTTGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16337 mir-245(n4798) I. C. elegans Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1635 lin-8(n111) II; lin-37(n758) III. C. elegans Double mutant is Muv. n758 alone is not Muv.
MT16426 set-9(n4949) IV. C. elegans F15E6.1 Tandem deletion/duplication.
MT16429 set-6(tm1611) lin-15A(n767) X. C. elegans Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.
MT1643 lin-36(n766) III; lin-15A(n767) X. C. elegans Double mutant is Muv. lin-36 alone is non-Muv.
MT16430 set-6(tm1611) lin-15B(n744) X. C. elegans Reference: Andersen EC & Horvitz HR., Development. 2007 Aug;134(16):2991-9.
MT16471 mir-60(n4947) II. C. elegans Deletion breakpoints are:GAAACTTGTTCTGATACAGTA / ATTTTCAAAGAACCATCCATG...GGGCTTATGGAATGGTAG / ATAGTTGAGACACAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16492 uaf-1(n4588) III. C. elegans Suppressor of unc-93(e1500). Weak maternal effect sterile and dumpy. Reference: Ma L, Horvitz HR. PLoS Genet. 2009 Nov;5(11):e1000708.
MT16494 mir-229&mir-64&mir-65&mir-66(nDf63) III. C. elegans Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16506 mir-254(n4470) X. C. elegans Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1652 unc-8(n773) IV. C. elegans Semi-dominant Unc.
MT16529 lin-61(n3447) I; lin-15A(n767) X. C. elegans SynMuv B. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT16530 lin-61(n3447) I; lin-8(n2731) II. C. elegans Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT16532 lin-61(n3447) I; lin-38(n751) II. C. elegans Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
MT1655 bli-6(n776) IV. C. elegans Blistered cuticle. Dominant.
MT1656 unc-108(n777) I. C. elegans Dominant Unc.
MT16696 mir-244(n4367) I. C. elegans Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1670 unc-1(n494) dpy-3(e27) X. C. elegans Dpy Unc. Semi-dominant Unc.
MT1671 unc-1(n496) lon-2(e678) X. C. elegans Dominant Coiler Unc. Lon.
MT1672 unc-8(n491) dpy-4(e1166) IV. C. elegans Dpy. Unc.
MT1676 unc-70(n493) dpy-11(e224) V. C. elegans DpyUnc. Semidominant Unc.
MT16762 mir-256(n4471) V. C. elegans Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).
MT1677 unc-1(n494) lon-2(e678) X. C. elegans Semi-dominant Coiler Unc. Lon.
MT1679 unc-105(n490) II; lon-2(e678) let-2(n821) X. C. elegans Long. n821 pka sup-20(n821).
MT1684 unc-105(n490n785) II. C. elegans Non-Unc.
MT16846 csp-1(n4967) II. C elegans n4967 is a 769 bp deletion that removes the putative protease active site. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT16848 mir-249(n4983) X. C. elegans Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1685 unc-105(n490n786) II. C. elegans Non-Unc.
MT16973 met-1(n4337) I. C. elegans Deletion of C43E11.3 splice donor for the 4th exon through exon 7.
MT170 egl-27(n170) II. C. elegans Egg laying defective. Retains late stage eggs. Males do not mate.
MT171 egl-34(n171) I. C. elegans Egg laying defective. Retains late stage eggs.
MT17121 set-17(n5017) II. C. elegans Reference: Development 134(16):2991-9 (2007).
MT17136 nDf67 IV; nDf58 X. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT17137 mir-51(n4473) IV; nDf58 X. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT17143 nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. C. elegans Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.
MT1720 unc-105(n490) II; let-2(n821) X. C. elegans n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.
MT1727 dpy-10(e128) lin-29(n482) II. C. elegans Dpy. Egg laying defective. Makes bags of worms. Abnormal vulva. Previously called egl-29(n482).
MT17428 mir-72(n4130) II; nDf47 X. C. elegans Reference: Curr Bio (2010) 20:367-73.
MT17429 nDf67 IV. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT1743 ced-3(n718) IV. C. elegans n718 is a strong allele of ced-3.
MT17431 nDf49 II; nDf59 V; mir-247(n4505) X. C. elegans mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.
MT17445 mir-62(n4539) X. C. elegans 993 bp deletion covering bases 11371-12364 of T07C5. Deletion covers mir-62 (11867-11890) and part of the predicted gene T07C5.6.
MT17446 mir-53(n4113) mir-52(n4100) IV; nDf58 X. C. elegans Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT17463 set-25(n5021) III. C. elegans Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).
MT176 lin-1(n176) IV. C. elegans Strong Muv.
MT17631 nDf56 IV; nDf60 V. C. elegans Reference: Curr Bio (2010) 20:367-73.
MT17676 mir-45(n4280) II; nDf59 V; mir-247(n4505) X. C. elegans nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73.
MT17810 mir-1(n4102) I. C. elegans Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1784 dpy-20(e1362) unc-31(e169) IV. C. elegans Dpy. Unc.
MT17848 mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. C. elegans mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT1789 sup-17(n316) I. C. elegans Dpy. Egl. Abnormal vulval cell lineages.
MT1790 unc-78(e1217) lin-18(e620) lon-2(e678) X. C. elegans Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon.
MT1799 lin-36(n766) unc-32(e189) III. C. elegans Unc.
MT17997 mir-235(n4504) I. C. elegans Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT180 sup-9(n180) II. C. elegans Suppresses unc-93(e1500).
MT1801 lin-38(n751) unc-52(e444) II; lin-9(n112) III. C. elegans Unc. Muv.
MT18016 nDf63 III; mir-63(n4568) X. C. elegans Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
MT18023 lin-4(e912) II; mir-237(n4296) X. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT1803 lin-8(n111) II; lon-1(e185) lin-37(n758) III. C. elegans Long. Muv.
MT18037 mir-75(n4472) X. C. elegans Deletion covering bases 34070-36042 on T24D8. This is a complete deletion of mir-75, which is on T24D8 (34374-34395).
MT18043 mir-240&mir-786(n4541) X. C. elegans Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1806 lin-15A(n767) X. C. elegans WT phenotype. Synthetic Muv.
MT1808 lin-38(n751) II. C. elegans
MT18143 nIs286 X. C. elegans nIs286 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
MT18144 nIs287 X. C. elegans nIs287 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
MT18145 nIs289 X. C. elegans nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50.
MT1821 lin-25(e1446) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Hets are Unc and segregate Unc, Vul and dead eggs. Maintain by picking Uncs.
MT18409 nDf53 III; mir-58.1(n4640) IV. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT18410 mir-58.1(n4640) IV; nDf54 X. C. elegans Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT1842 lin-14(n536n838) X. C. elegans Vulva abnormal.
MT1848 lin-14(n360) X. C. elegans Temperature sensitive.
MT1851 lin-14(n727) X. C. elegans
MT1853 unc-86(n843) III. C. elegans Him. Lethargic. Mec. Egl.
MT1855 unc-86(n844) III. C. elegans Unc. Egl. Non-Him.
MT1857 unc-86(n845) III. C. elegans Unc. Non-him.
MT1859 unc-86(n846) III. C. elegans Unc.
MT1861 unc-86(n847) dpy-19(e1259) III. C. elegans Unc-Lethargic. Mec. Egl. ts Dpy. n847 has a Him phenotype.
MT1862 unc-86(n848) III. C. elegans Unc. Temperature sensitive allele.
MT18690 sfa-1(n5223) IV/nT1 [qIs51] (IV;V). C. elegans Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
MT18778 nIs348 IV; lin-15AB(n765) X. C elegans nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707
MT19075 nIs352. C. elegans nIs352 [eya-1p::GFP::eya-1 + rol-6(su1006)]. Rollers. Rescuing array was integrated in eya-1(tm759) background. Reference: Hirose T, Galvin BD, Horvitz HR. Proc Natl Acad Sci U S A. 2010 Aug 31;107(35):15479-84.
MT1908 nDf21/dpy-19(e1259) unc-32(e189) III. C. elegans Heterozygotes are Dpy and segregate Dpy, DpyUncs and dead eggs.
MT19085 hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
MT1909 nDf22/dpy-19(e1259) unc-32(e189) III. C. elegans Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs. e1259 has a ts maternal effect.
MT19110 nIs363 X. C. elegans nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]
MT1927 egl-2(n693n904) V. C. elegans Revertant.
MT19321 unc-93(e1500) III. C. elegans Use as a replacement strain for SP457. Rubberband Unc.
MT19372 sptf-3(n4850) I; nIs283 X. C. elegans nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.
MT19454 nIs396 V. C. elegans nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27
MT19635 lin-15B&lin-15A(n765) X; nIs407. C. elegans nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
MT1965 lin-12(n941)/eT1 III; him-5(e1467)/eT1 [him-5(e1467)] V. C. elegans Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.
MT19703 nIs394 III; lin-15B&lin-15A(n765) X. C. elegans nIs394 [ngn-1::GFP + lin-15(+)] III. Translational GFP reporter. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27.
MT1975 egl-5(n945) III. C. elegans Egl. Coiler. HSN-.
MT19756 nIs408 I. C. elegans nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.
MT1976 unc-86(n946) III. C. elegans HSN-. Egl. Mec.
MT1978 nDf16/unc-36(e251) dpy-19(e1259) III. C. elegans Heterozygotes are Unc and segregate Unc, DpyUnc (Dpy is ts) and dead eggs. Maintain by picking Uncs.
MT19851 sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. C. elegans nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT19859 nIs431 X. C. elegans nIs431 [GFP::sptf-3] X. GFP::SPTF-3 is ubiquitously expressed. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT200 unc-93(n200) III. C. elegans Weak Rubberband.
MT2003 lin-28(n719) unc-29(e403) I. C. elegans Egl. Unc.
MT2007 dpy-5(e61) lin-28(n719) I. C. elegans Dpy. Egl.
MT20088 his-9(n5357) II. C. elegans Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.
MT20108 dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs281 III. C. elegans nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT. Segregates Dpy Sterile and Dpy Unc.
MT20109 dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. C. elegans nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1. Fails to complement all markers on qC1. Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc.
MT20110 unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. C. elegans nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
MT20111 unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. C. elegans nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
MT20112 +/eT1 III; unc-46(e177) dpy-11(e224)/eT1 nIs267 V. C. elegans nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20113 unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. C. elegans nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20114 eT1 (III;V); nIs267 V. C. elegans nIs267 [myo-2::GFP] integrated in or near eT1. Unc.
MT2015 lin-28(n947) I. C. elegans L3 alae. L4 blip.
MT20187 rba-1(n5418) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.
MT2021 lin-12(n952) III; him-5(e1467) V. C. elegans Muv. Throws males.
MT20298 nIs408 I; nIs454 II. C. elegans nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.
MT20434 chaf-1(n5453) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.
MT20492 lin-15B&lin-15A(n765) X; nIs471. C. elegans nIs471 [lgc-55::GFP + lin-15(+)]. GFP expression in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100.
MT2060 egl-1(n987) V. C. elegans Egl. Dominant allele. Reference: Genetics 121(4):703-21 (1989).
MT2068 egl-42(n995) II. C. elegans Semidominant Egl.
MT2069 egl-42(n996) II. C. elegans n996 is a semi-dominant allele of egl-42. Reference: Genetics (1989) 121:703-21.
MT2072 egl-45(n999) III. C. elegans Egl. Sluggish.
MT2115 nDf27/nT1 IV; +/nT1 V. C. elegans Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT.
MT2121 lin-33(n1043) IV. C. elegans Vul.
MT2123 let-23(n1045) II. C. elegans Homozygous viable. Vulvaless. Cold Sensitive.
MT2124 let-60(n1046) IV. C. elegans Non-lethal let-60 allele, multivulva phenotype (93% penetrance). Semi-Dominant (17% of hets are Muv). Amber suppressible. Non-null. PKA lin-34. See WBPaper00006902: strain probably carries a side mutation(s) that impairs chemotaxis to the odorant isoamyl alcohol.
MT2125 lin-1(n1047) IV. C. elegans Strong Muv.
MT2129 lin-18(n1051) X. C. elegans Biv. Temperature-sensitive amber allele. Reference: Genetics (1985) 110:17-72.
MT2131 lin-31(n1053) II. C. elegans Muv.
MT2136 lin-3(n1058)/unc-8(e49) dpy-20(e1362) IV. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Steriles (n1058 homozygotes). The n1058 homozygous larvae are occasionally paralyzed. Maintain by picking WT.
MT2138 nDf29/unc-13(e1091) lin-11(n566) I. C. elegans
MT2139 nDf30/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are Vul and segregate Vul, UncVul and dead eggs. Maintain by picking Vul non-Unc.
MT21394 nIs540 X. C. elegans nIs540 [pig-1p::GFP + rol-6(su1006)] X. Rollers. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT2142 rol-1(e91) lin-38(n751) unc-52(e444) II; lin-9(n112) III. C. elegans Muv. Unc. Roller.
MT2147 lin-8(n111) II; unc-93(e1500) lin-9(n112) III. C. elegans Rubberband Unc. Muv.
MT21478 set-17(n5017) II ; unc-119(ed3) III ; nSi3 IV C. elegans nSi3 [set-17p::set-17(+)::GFP::set-17 3’UTR + unc-119(+)] IV. nSi3 expresses a translational fusion of genomic set-17 and GFP. nSi3 rescues the brood size defect of n5017 in this strain. nSi3 is a single copy MOS-mediated transposition into the cxTi10882 site; GFP detectable in the nuclei of the hypoderm, sperm and proximal germline, as well as some other cells. Reference: Engert CG, et al. PLoS Genet. 2018 Apr 27;14(4):e1007295.
MT21485 nIs578 IV. C. elegans nIs578 [pGEM-T/sptf-3(+) + myo-3p::mCherry] IV. Rollers. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
MT2150 lin-31(n301) unc-85(e1414) II. C. elegans Muv. Unc.
MT2179 nDf25/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are WT and segregate WT, UncVul and dead eggs. The UncVuls are small, kinky, paralyzed and vulvaless. Maintain by picking WT.
MT21793 lite-1(ce314) gur-3(ok2245) X. C. elegans Defective locomotion in response to blue/UV light. Double mutant has almost no response to light. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18.
MT2180 nDf23/unc-13(e1091) lin-11(n566) I. C. elegans Heterozygotes are WT and segregate WT, UncVul and dead eggs. UncVuls are small, kinky, paralyzed and vulvaless. Maintain by picking WT.
MT2181 nDf24/unc-13(e1091) lin-11(n566) I. C. elegans Hets are WT and segregate WT, dead eggs, and VulUnc. VulUncs are small, kinky, paralyzed and vulvaless. Maintain by picking WT.
MT21910 lin-15AB(n765) X; nEx2065. C elegans nEx2065 [gur-3p::GFP + lin-15(+)]. Maintain by picking non-Muv. GFP expression in I2, I4, AVD and PVC. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. PMID: 25640076.
MT2214 egl-32(n155) I; daf-3(e1376) X. C. elegans Temperature sensitive Egl. Dauer defective.
MT2215 egl-32(n155) I; daf-5(e1386) II. C. elegans Temperature sensitive Egl. Dauer defective.
MT2236 egl-1(n4065) V. C. elegans Egl. [10/02: This strain was previously listed as being sel-10(n1069) or egl-41(n1069); these were found to be incorrect and the mutation is now called egl-1(n4065). H. Schwartz comm.]
MT2242 egl-46(n1075) V. C. elegans Egl.
MT2243 egl-46(n1076) V. C. elegans Egl.
MT2244 sel-10(n1077) V. C. elegans Egl. 5HT-S, IMIP-R. Mutation causes G567E coding change. n1077 previously called egl-41.
MT2246 egl-43(n1079) II. C. elegans Egl. Mate with about 50% of WT efficiency.
MT2247 egl-44(n1080) II. C. elegans Egl. Grows more slowly than WT.
MT2248 egl-47(n1081) V. C. elegans Dominant egg laying defective. Slightly Unc.
MT2251 egl-1(n1084) V. C. elegans Egl. Semi-dominant allele. Reference: Genetics 121(4):703-21 (1989).
MT2253 egl-50(n1086) II. C. elegans Semi-dominant Egl. See also WBPaper00001133.
MT22914 gcn-1(n4827) III. C elegans n4827 is a null allele of gcn-1 and that loss of gcn-1 function causes a defect in M4 sister cell death. Reference: Hirose T & Horvitz HR. PLoS Genet. 2014 Aug 7;10(8):e1004512.
MT2292 tra-2(n1106) II. C. elegans HSN(-) Egl. Weak allele.
MT2293 egl-49(n1107) X. C. elegans HSN(-) Egl.
MT2294 egl(n1108) V. C. elegans Temperature sensitive. Wild type at 15C. Egl at 25C. HSN-. Egl.
MT2306 lin-28(n1119) I. C. elegans Precocious.
MT23129 lin-15AB(n765) X; nEx2287. C elegans nEx2287 [egl-6Ap::gur-3 + lin-15(+)]. Pick non-Muv to maintain. Exposure to light induces egg-laying. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.
MT2315 egl-46(n1226) V. C. elegans HSN-. Egl. Unc
MT2316 egl-46(n1127) V. C. elegans Slightly Unc. Abnormal Q lineage. Males mate with about 50% efficiency of WT. Egl.
MT23160 lin-15AB(n765) X; nIs534; nEx2314. C elegans nIs534 [odr-1p::GCaMP3 + lin-15(+)]. nEx2314 [odr-1p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. odr-1p::gur-3 expression in AWC and AWB causes them to respond to light exposure. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.
MT23162 kyIs511 V; nEx2316. C elegans kyIs511 [gcy-36p::GCaMP + unc-122p::GFP]. nEx2316 [gcy-36p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. Expression of gcy-36p::gur-3 causes URX to respond to light 30% of the time. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.
MT2324 unc-42(e270) egl-47(n1082) V. C. elegans Unc. Dominant Egl.
MT2330 dpy-17(e164) lon-1(e1820) III. C. elegans
MT23338 nIs686 III; lin-15B&lin-15A(n765) X. C. elegans nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
MT2343 dpy-19(e1259) lin-12(n137)/unc-32(e189) lin-12(n137n720) III. C. elegans Heterozygotes are Muv and Egl (n137 is semi-dominant) and segregate DpyMuv and Unc lethals (most arrest as L1-L3, the few survivors are sterile, scrawny, Unc and have a large ventral blip at hte position of the vulva). Maintain by picking non-Dpy non-Unc.
MT2351 lin-10(e1439) I; dpy-19(e1259) lin-12(n137)/unc-32(e189) lin-12(n137n720) III. C. elegans Heterozygotes are Muv. Segregates DpyMuv and Unc.
MT2379 lin-17(n671) lin-11(n382) I. C. elegans
MT2405 ced-3(n717) unc-26(e205) IV. C. elegans Unc. Abnormal cell death. Cells that normally die survive.
MT2422 lon-1(n1130) III. C. elegans Long. Can split in two.
MT2426 goa-1(n1134) I. C. elegans Hyperactive. n1134 is a G to A substitution in the initiation codon of goa-1.
MT2490 unc-3(e151) lin-15B&lin-15A(n765) X. C. elegans Unc. Temperature sensitive Muv.
MT2495 lin-15B(n744) X. C. elegans
MT2509 unc-103(n500) III. C. elegans Semi-dominant Unc.
MT2537 dpy-13(e184) unc-8(n491) IV; him-5(e1490) V. C. elegans DpyUnc. e184 and n491 are both semi-dominant.
MT2547 ced-4(n1162) III. C. elegans Cells that normally die survive. [3/02: A mutation that was not reported (nucleotide 1251 C-> T causing codon 80 ->ochre) was found by Tak Hung. It turns out the mutation was misannotated in the original paper (Development, 1992, 116:309). Bob Horvitz also confirmed the discovery.
MT2550 unc-79(e1068) ced-4(n1162) III. C. elegans Unc. Cells that normally die survive.
MT2551 ced-4(n1162) dpy-17(e164) III. C. elegans Dpy. Cells that normally die survive.
MT2557 ces-1(n703) I. C. elegans Sister cells of NSM and I2 neurons fail to undergo programmed cell death. Other cell deaths unaffected. Semi-dominant.
MT2563 ced-3(n1165) IV; egl-1(n487) V. C. elegans n1165 blocks cell death. Temperature sensitive Egl. Semi-dominant Egl.
MT2583 dpy-11(e224) nDf32 V/eT1 (III;V). C. elegans Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.
MT2590 +/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
MT2591 +/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
MT2592 +/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.
MT2598 unc-43(n498n1179) IV. C. elegans
MT2605 unc-43(n498n1186) IV. C. elegans
MT2609 egl-30(n715n1190) I. C. elegans Non-Egl.
MT2611 unc-8(n491n1192) IV. C. elegans WT revertant.
MT2612 unc-8(n491n1193) IV. C. elegans WT. Intragenic revertant.
MT2613 unc-8(n491n1194) IV. C. elegans WT revertant.
MT2614 unc-8(n492n1197) IV. C. elegans WT revertant.
MT2615 unc-8(n492n1198) IV. C. elegans WT revertant.
MT2616 unc-8(n491n1195) IV. C. elegans WT revertant.
MT2617 unc-8(n491n1196) IV. C. elegans WT revertant.
MT2618 unc-8(n492n1199) IV. C. elegans WT revertant.
MT2621 unc-1(e1598n1201) dpy-3(e27) X. C. elegans DpyUnc. Unc not dominant.
MT2624 unc-1(e1598n1204) dpy-3(e27) X. C. elegans n1204 is a kinky Unc. Dpy.
MT2633 unc-103(n500n1211) III. C. elegans Non-Unc.
MT2635 unc-103(e1597n1213) III. C. elegans Intragenic revertant.
MT2636 unc-103(e1597n1214) III. C. elegans Revertant. WT phenotype.
MT26375 lin-15B&lin-15A(n765) X; nEx3045. C. elegans nEx3045 [C32F10.8p::GCaMP3::unc-54 3' UTR + lin-15(+)]. Pick non-Muv animals to maintain array. Line is quite stable, ~80% transmission. Expression of GCaMP3 in pm3, mc1, and in other pharyngeal cells posterior to pm3. Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
MT2663 sqt-3(sc63) him-5(e1467) egl-1(n986) unc-76(e911) V. C. elegans Dominant Egl. Unc. Dpy (ts). Throws males.
MT2709 rol-6(e187n1270) II. C. elegans Revertant. Phenotypically WT.
MT2712 unc-58(n495n1273) X. C. elegans Revertant of dominant Unc. WT.
MT2713 unc-105(n1274) II. C. elegans Unc.
MT2718 let-2(n1279) unc-3(e151) X; mnDp26 (X;f). C. elegans n1279 is lethal. Animals which are alive contain the duplication. n1279 pka sup-20.
MT2764 unc-9(e101) lin-15B&lin-15A(n765) X. C. elegans Temperature-sensitive Lin.
MT2773 sup-17(n1260) I. C. elegans Temperature sensitive. Sup Vul. Egl of n302.
MT2801 unc-4(e120) egl-43(n997) II; egl-46(n1127) V. C. elegans Unc. Egl.
MT2816 egl-44(n1080) unc-4(e120) egl-43(n997) II. C. elegans Unc. Egl.
MT2840 dig-1(n1321) III. C. elegans
MT2845 egl-5(n945) III; him-5(e1467) egl-1(n986) V. C. elegans n945: HSN- . Egl. Coiler.
MT2867 unc-36(e251) III; unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) lin-15B&lin-15A(n765) X. C. elegans
MT2936 unc-13(e51) I; nDp4 (I;V)/+. C. elegans Animals heterozygous for the duplication are WT. Animals which have lost the duplication are Unc. Animals homozygous for the duplication are viable. They are small, sickly Egl worms which don't give rise to Uncs.
MT2940 unc-31(n1304) IV. C. elegans Temperature sensitive.
MT2941 sup-17(n1305) unc-29(e1072) I. C. elegans ts. Dpy. Egl. sup of lin-12(d).
MT2956 dpy-14(e188) unc-29(e1072) I. C. elegans ts Dpy. e1072am.
MT2966 sup-17(n1313) unc-29(e1072) I. C. elegans Suppressor of lin-12(d).
MT2967 sup-17(n1314) unc-29(e1072) I. C. elegans Suppressor of lin-12(d).
MT2969 sup-17(n1316) unc-29(e1072)/dpy-14(e188) I. C. elegans Heterozygotes are WT and segregate WT, Dpys and very slow growing Uncs. Maintain by picking WT.
MT2970 sup-17(n1317) unc-29(e1072) I. C. elegans Suppressor of lin-12(d).
MT2981 lin-10(n1299n1326) I. C. elegans Vul.
MT3002 ced-3(n1286) IV. C. elegans Absence of cell death. Strong allele.
MT301 lin-31(n301) II. C. elegans Multi-vulva. Recessive.
MT302 lin-12(n302) III. C. elegans Vulvaless. Semi-dominant. Males mate.
MT3022 nDf20/sma-2(e502) unc-32(e189) III. C. elegans Heterozygotes are WT and segregate WT, SmaUnc and dead eggs. Maintain by picking WT.
MT3025 let-23(n1045) II; lin-13(n387) unc-36(e251)/unc-32(e189) III. C. elegans Heterozygotes are Vulvaless and segregate more Vul, Vul Unc-36 and Vul Unc-32. n1045 is cold sensitive-strain gives some arrested larvae (L2) which look like little sticks.
MT3026 lin-8(n111) II; sma-3(e491) lin-37(n758) unc-36(e251) III. C. elegans Small. Unc. Muv.
MT303 lin-1(n303) IV. C. elegans Muv.
MT3033 unc-13(e1091) lin-35(n745) I. C. elegans Unc.
MT3040 lin-8(n111) II; sma-3(e491) unc-36(e251) III. C. elegans SmaUnc. Not Muv.
MT306 unc-86(n306) III. C. elegans Bloated. Mec. Egl. Him.
MT3061 lin-8(n111) II; sma-3(e491) lin-13(n387) unc-36(e251)/sma-3(e491) lin-37(n758) III. C. elegans Heterozygotes are Sma. At 25C, hets segregate Sma, SmaMuv (lin-8; sma-3 lin-37), and SmaUncMuvSte (lin-8; sma-3 lin-13 unc-36). At 15C, hets segregate Sma, SmaMuv (lin-8; sma-3 lin-37) and SmaUnc which give sterile F2 (lin-8; sma-3 lin-13 unc-36). n387 is a ts maternal effect mutation.
MT3063 lin-12(n950) III. C. elegans Muv. Semi-dominant.
MT308 lin-7(n308) II. C. elegans
MT309 lin-15B&lin-15A(n309) X. C. elegans Multivulva. See also WBPaper00001990. n309 extends into both lin-15B and lin-15A.
MT3123 unc-49(n1324n1345) III. C. elegans Wild-type revertant of n1324.
MT3124 lon-2(n1346)/dpy-8(e130) X. C. elegans Heterozygotes are WT and segregate more WT, Dpys and dead eggs.
MT3126 mut-2(r459) I; dpy-19(n1347) III. C. elegans Very mildly Dpy Tc1-induced dpy-19 allele. Generates severe Dpys when Tc1 hops out of dpy-19 (doesn't excise cleanly). See also WBPaper00001672. [Some concern whether the Mut phenotype in this strain is actually mut-2 because it showed no transposition of Tc3 or other Tc's besides Tc1. 1/95.]
MT3148 mig-1(n1354) I. C. elegans Low penetrance Egl. HSN migration defective.
MT3149 ham-2(n1332) X. C. elegans Egl. HSNs are migration defective and defective in serotonin expression. See also WBPaper00003422.
MT3179 sem-4(n1378) I. C. elegans Sex muscles are absent. Egl.
MT318 him-11(n318) III. C. elegans 5% XO self-progeny.
MT3191 unc-29(x520) I. C. elegans
MT3192 unc-29(x522) I. C. elegans
MT3193 unc-29(x544) I. C. elegans
MT3198 unc-13(e1091) unc-29(e1072) I. C. elegans
MT3214 sem-2(n1343) I. C. elegans Egl. Defective in sex muscles (missing).
MT3228 lin-10(n1386) I. C. elegans Vulvaless.
MT3229 lin-10(n1387) I. C. elegans Vulvaless.
MT3232 lin-10(n1390) I. C. elegans Vul.
MT324 unc-40(n324) I. C. elegans
MT3248 bli-4(e937) sem-4(n1378) I. C. elegans
MT3252 lin-10(n1402) I. C. elegans Vulvaless.
MT3286 unc-93(e1500n1412) III. C. elegans Wild type. n1412 loss-of-function suppresses the e1500sd rubberband phenotype.
MT3289 unc-93(e1500n1415) III. C. elegans Wild type. n1415 loss-of-function suppresses the e1500sd rubberband phenotype.
MT3315 ced-4(n1416) III; egl-1(n986) V. C. elegans Absence of cell death. See WBG 10(1):31.
MT3316 lin-4(e912)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans
MT3324 lon-2(e678) egl-15(n484) X. C. elegans
MT3329 unc-93(e1500n1419) III. C. elegans Wild Type.
MT3351 egl-17(e1313) unc-1(e580) X. C. elegans Egl. Unc.
MT3353 egl-15(n484) sma-5(n678) X. C. elegans Small. Egl. Slow growing.
MT3363 daf-2(e1370) dpy-17(e164) III. C. elegans Dpy. Daf-C. Maintain at 15C.
MT3414 dpy-20(e1282) unc-31(e169) unc-26(e205) IV. C. elegans Dpy Unc.
MT3443 egl-15(n484) sdc-1(n485) X. C. elegans
MT3453 lin-15B&lin-15A(n765) let-2(b246) X. C. elegans Temperature sensitive Muv. Temperature sensitive lethal above 20C.
MT3497 dpy-17(e164) sup-18(n1014) III; sup-10(n983) X. C. elegans Animals are Dpy non-Unc.
MT3516 lin-1(e1275) cha-1(p1152) IV. C. elegans Temperature sensitive Multi-vulva. Slow growing. Unc-coils, jerky going backward. Small.
MT355 lin-14(n355) X. C. elegans Semi-dominant.
MT3551 ham-1(n1438) IV. C. elegans HSN defective. Egl. Altered FITC loading of amphid/phasmid.
MT3553 egl-43(n997) II; unc-76(e911) V. C. elegans n997: Egl, 5HT-S, IMIP-R.
MT3564 osm-7(n1515) III. C. elegans Weak and variable Osm. Recessive.
MT3575 che-13(n1520) I. C. elegans Osm. FITC filling defective.
MT3589 sup-9(n1435) lin-31(n301) II; sup-10(n983) X. C. elegans Non-rubberband. Muv.
MT3608 unc-13(e51) ced-1(e1735) I. C. elegans Unc. Abnormal cell death.
MT3618 unc-75(e950) ced-1(n1506) unc-59(e261) I. C. elegans
MT363 goa-1(n363) I. C. elegans Hyperactive.
MT3632 lin-10(n1511) unc-29(e1072) I. C. elegans Vul. Unc-Very sluggish as L1, moves better as adult. Weak kinker. Head region stiff. Moves better in reverse, fairly active.
MT3637 lin-11(n566) unc-75(e950) I. C. elegans
MT3641 osm-10(n1602) III. C. elegans Osmotic avoidance defective. FITC fills most amphid cells.
MT3645 osm-12(n1606) III. C. elegans Semidominant osmotic avoidance defective. FITC fills normally.
MT3661 sup-9(n1550) II; unc-93(n1415) dpy-17(e164) III. C. elegans Dpy. unc-93(n1415) loss-of-function suppresses the sup-9(n1550) Rubberband phenotype.
MT3664 ric-1(n1600) III. C. elegans Osmotic avoidance defective. FITC fills normally. Previously called osm-13.
MT372 lin-22(n372) IV. C. elegans
MT3751 dpy-5(e61) I; rol-6(e187) II; unc-32(e189) III. C. elegans
MT3773 unc-42(e270) vab-8(e1017) V. C. elegans Unc. Posterior half thin and pale.
MT3778 ced-1(e1735) unc-54(e1092) I. C. elegans Unc. Abnormal cell death.
MT378 lin-3(n378) IV. C. elegans Vulvaless. Isolated in lin-8(n111); this strain may still contain n111.
MT3790 unc-115(e2225) egl-15(n484) X. C. elegans n484: Egl, displaced muscles. e2225: Unc-lethargic and kinker.
MT3807 lin-17(n671) sup-11(n403) I. C. elegans Bivulva. n403 is homozygous scrawny.
MT382 lin-11(n382) I. C. elegans Vul.
MT383 lin-1(n383) IV. C. elegans Strong Muv.
MT3840 unc-93(e1500n1415) dpy-17(e164) III; twk-18(e1913)/+ X. C. elegans Pick DpyUnc worms to maintain, as e1913 is a dominant Unc and a recessive lethal. Actually, the Uncs are not very Dpy, so pick non-Dpy-looking animals that don't move well. e1913 previously called unc-110.
MT3847 lon-2(n1630) X. C. elegans Long.
MT3881 lin-2(n1610) X. C. elegans Vul. Suppressor of lin-15(n765).
MT3894 lin-25(n1722) V. C. elegans Vulvaless suppressor of lin-1(e1275).
MT3918 unc-5(e53) sem-3(n1655) IV. C. elegans
MT3964 sup-9(n1550) II; lin-15B&lin-15A(n765) sup-10(e2127) X. C. elegans n765 is temperature-sensitive Muv. Loss-of-function of sup-10(e2127) suppresses the sup-9(n1550) Rubberband mutation.
MT3969 mig-1(n1652) I. C. elegans Low penetrance Egl. HSN migration defective.
MT397 lin-2(n397) X. C. elegans 77% Vul. Probably has a linked suppressor mutation - see WBPaper00002382.
MT3970 mab-5(mu14) ced-9(n1653) III. C. elegans Temperature sensitive. About 50% HSN missing. Mab confirmed by Hillel Schwartz 12/5/00. Rec'd new stock from Horvitz lab 12/2000. [NOTE: The genotype of this strain was incorrectly described as carrying mab-5(mu114); however, the actual allele is mab-5(mu14).]
MT3971 ham-3(n1654) III. C. elegans Egl. HSNs are migration defective and defective in serotonin expression.
MT4006 lin-10(n1759) I. C. elegans Vul.
MT4007 lin-39(n1760) III. C. elegans Vulvaless. Strong loss of function allele.
MT4009 lin-39(n1760)/dpy-17(e164) unc-32(e189) III. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Vul. Pick WT to maintain.
MT405 dpy-1(e1) lon-1(e185) III. C. elegans
MT4106 clr-1(e1745) dpy-10(e128) II. C. elegans Maintain at 15C.
MT4150 unc-17(e245) dpy-4(e1166) IV; him-5(e1490) V. C. elegans DpyUnc. Segregates males.
MT4156 lin-26(n156)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. C. elegans Heterozygotes are WT and segregate WT, Egls with abnormal tails and DpyUncs.
MT4244 unc-24(e138) let-60(n1046) IV. C. elegans Unc. Muv (sd, gf).
MT4306 lin-39(n1490) unc-36(e251) III. C. elegans Unc. Vulvaless (temperature sensitive-91% Vul at 15C and 100% Vul at 20C and 25C). n1490 is also temperature sensitive Unc.
MT4351 lin-10(n1853) I. C. elegans Vul.
MT4417 ced-5(n1812) dpy-20(e1282) IV. C. elegans Dpy. Persistent cell corpses. Maternal effect. Recessive.
MT4433 ced-6(n1813) III. C. elegans Dead cells persist. Maternal rescue of embryonic.
MT4434 ced-5(n1812) IV. C. elegans Persistent cell corpses. Maternal effect. Recessive.
MT4446 unc-34(e566) unc-60(e677) dpy-11(e224) V. C. elegans Dpy. Unc.
MT4479 soc-2(n1774) IV. C. elegans Suppressor of clr-1(e1745) at 25C.
MT4491 lin-39(n1872) III. C. elegans Vulvaless. Temperature sensitive. Suppressor of n765.
MT4498 lin-39(n1880) III. C. elegans Vulvaless. Strong loss of function allele.
MT4500 lin-39(n1880)/dpy-17(e164) unc-32(e189) III. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Vul. Pick WT to maintain.
MT4535 unc-93(e1500n1912) III. C. elegans Non-Unc.
MT455 lon-2(e678) unc-18(e81) X. C. elegans Unc. Long.
MT4552 unc-74(e883) bli-4(e937) unc-87(e1459) I. C. elegans Blistered Uncs.
MT4574 let-60(n1531)/let-60(n1046) unc-22(e66) IV. C. elegans Heterozygotes are WT and segregate WT, MuvUnc (n1046 e66) and n1531 homozygotes whose phenotypes range from a few dead larva to sterile adults. The normal larval lethality of n1531/n1531 is suppressed by the maternal contribution of n1046. n1046 is semi-dominant.
MT4578 lin-1(e1275) dpy-13(e184) IV; unc-9(e101) X. C. elegans Temperature sensitive Muv. Semi-dominant Dpy. Unc-moves backward better than forward; slight kinker in forward movement; larvae more severly Unc.
MT458 unc-20(e112) lon-2(e678) X. C. elegans Lon. Unc-ts.
MT4628 nDf27 IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT and dead eggs.
MT4629 mars-1(s254) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Lethal Twitchers and dead eggs. Lethal mid-larval; some twitchers make it to almost adults but are always sterile. Maintain by picking WT.
MT464 unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) X. C. elegans Mapping strain. DpyUnc.
MT465 dpy-5(e61) I; bli-2(e768) II; unc-32(e189) III. C. elegans Mapping strain. DpyUnc.
MT468 dpy-7(e88) unc-6(n102) X. C. elegans Dpy. Unc. Retains eggs.
MT4684 lin-3(n1059) dpy-20(e1362)/unc-24(e138) mec-3(e1338) dpy-20(e1282) IV. C. elegans Heterozygotes are Dpy and segregate Dpy, Dpy Lethals (early larval) and DpyUncMec.
MT4698 let-60(n1700) IV. C. elegans Muv.
MT4700 let-60(n1531) unc-22(e66)/let-60(n1700) dpy-20(e1282) IV; him-5(e1490) V. C. elegans Heterozygotes are mostly non-Muv (about 20% will be Muv because n1700 is semi-dominant) and non-Unc. Hets segregate Twitchers which die at various larval stages or as Vul adults, because of the maternal effect rescue of n1531 by n1700. The Twitchers will not give viable progeny. Hets also segregate DpyMuvs. The strain segregates males which will mate, though not very well.
MT4705 lin-17(n671) lin-44(n1792) I; him-5(e1490) V. C. elegans
MT4718 egl-31(n472) I; him-5(e1490) V. C. elegans Egg laying defective. Makes bags of worms. Backward Unc. Throws males.
MT4725 let-60(n1046) dpy-20(e1282) IV. C. elegans Dpy (ts). Muv (sd, gf).
MT4755 sem-5(n2019) X. C. elegans Vulvaless. 41% die as L1 or early L2.
MT4770 ced-9(n1950) III. C. elegans Dominant maternal effect. Survival of cells which normally undergo programmed cell death.
MT4810 odr-3(n2046) V. C. elegans Chemotaxis defective.
MT4816 sqt-2(sc3) lin-31(n301) II. C. elegans
MT4818 unc-70(n493) V. C. elegans Semi-dominant Unc.
MT4828 let-60(n2031)/dpy-20(e1362) unc-22(e66) IV. C. elegans n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).
MT4837 sma-3(e491) lin-39(n1490) III. C. elegans Small. Vulvaless (temperature sensitive-91% Vul at 15C and 100% Vul at 20C and 25C). n1490 is also temperature sensitive Unc.
MT4866 let-60(n2021) IV. C. elegans Lethal suppressor of lin-15(n765).
MT4867 unc-5(e53) lin-45(n2018) IV. C. elegans Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul.
MT4884 lin-11(n1281) I. C. elegans Vul.
MT491 him-5(e1467) V; lin-2(e1309) X. C. elegans Vulvaless. Segregates males.
MT4917 unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. C. elegans
MT4925 glp-1(q231) ced-7(n1892) unc-69(e587) III. C. elegans Maintain at 15C. glp-1(q231) is temperature sensitive. Unc. ced-7(n1892) causes persistent cell corpes and has a maternal effect.
MT4930 ced-1(n1995) I. C. elegans Cell corpses unengulfed.
MT4933 ced-1(n2089) I. C. elegans Unengulfed cell corpses.
MT4942 ced-1(e1735) I; ced-5(n1812) IV. C. elegans
MT4945 ced-1(e1735) I; ced-6(n1813) III. C. elegans n1813: dead cells persist; maternal rescue of embryonic.
MT4947 ced-1(e1735) I; unc-32(e189) ced-7(n1892) III. C. elegans Cell corpses persist. Unc. n1892 is the strongest allele of ced-7.
MT4951 ced-1(e1735) I; ced-10(n1993) IV. C. elegans n1993: cell corpses unengulfed.
MT4952 ced-2(n1994) IV. C. elegans Cell corpses unengulfed.
MT4954 dpy-9(e12) ced-2(e1752) unc-33(e204) IV. C. elegans Dpy. Unc. Abnormal Cell Death.
MT4960 ced-7(n1892) III; ced-2(e1752) IV. C. elegans ced-7(n1892): strongest allele, cell corpses persist.
MT4962 ced-5(n2002) IV. C. elegans Cell corpses unengulfed.
MT4970 ced-6(n2095) III. C. elegans Persistent cell corpses. Maternal effect. Recessive.
MT4979 lon-1(e185) ced-6(n1813) unc-32(e189) ced-7(n1892) III. C. elegans ced-6(n1813): dead cells persist, maternal rescue of embryonic. Unc. Long.
MT4981 lon-1(e185) ced-6(n1813) III; ced-10(n1993) IV. C. elegans ced-10(n1993): cell corpses unengulfed. Long.
MT4982 ced-7(n1892) III. C. elegans Persistent cell corpses. Maternal effect. Recessive.
MT4983 ced-7(n1996) III. C. elegans Cell corpses unengulfed. Strong allele.
MT4984 ced-7(n1997) III. C. elegans Cell corpses unengulfed.
MT4993 dpy-17(e164) ced-7(n1892) III. C. elegans Dpy. Maternal effect persistent cell corpses.
MT4995 sma-2(e502) ced-7(n1892) III. C. elegans Small. Maternal effect persistent cell corpses.
MT4996 sma-2(e502) ced-7(n1892) unc-69(e587) III. C. elegans
MT4997 unc-32(e189) ced-7(n1892) III. C. elegans Unc. Persistent cell corpses-Maternal effect.
MT5000 unc-32(e189) ced-7(n1892) III; ced-10(n1993) IV. C. elegans Unc.
MT5006 ced-8(n1891) X. C. elegans Engulfment of cell corpses defective. Zygotic recessive.
MT5007 ced-8(n1999) X. C. elegans Cell corpses unengulfed.
MT5013 ced-10(n1993) IV. C. elegans Persistent cell corpses.
MT5044 ces-2(n732) I. C. elegans Sister cells of NSM neurons fail to undergo programmed cell death. Other cell deaths unaffected. 60% penetrance at 25C; 10% penetrance at 15C.
MT5101 lin-39(n2110) III. C. elegans Vulvaless.
MT5103 lin-31(n301) dpy-10(e128) II. C. elegans Dpy. Variable Muv.
MT5166 ced-3(n1040) IV. C. elegans
MT5222 sem-5(n2030)/unc-10(e102) xol-1(y9) dpy-6(e14) X. C. elegans Heterozygotes are WT and segregate WT, Vuls (bags) and DpyUncs. n2030: Vul; impenetrant Mel (rod-like larval-lethal).
MT5240 unc-5(e53) lin-33(n1043) bli-6(sc16) IV. C. elegans Unc. Vul. Blistered.
MT5241 unc-5(e53) unc-44(e362) IV. C. elegans Unc.
MT5242 unc-5(e53) bli-6(sc16) IV. C. elegans Blistered Unc.
MT5259 unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. C. elegans
MT5260 unc-86(n946) ced-7(n1892) unc-50(e306) III. C. elegans
MT5265 lin-39(n2010) III. C. elegans Vul. Strong loss of function allele.
MT5277 dpy-17(e164) unc-36(e251) III. C. elegans DpyUnc.
MT5287 ced-4(n1894) III. C. elegans
MT529 him-5(e1467) V; lin-14(n179) X. C. elegans Abnormal vulva (temperature sensitive). Segregates males.
MT5332 lin-9(n942)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and Steriles. n942 homozygotes are sterile.
MT5335 lin-9(n943)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and Steriles. n943 homozygotes are sterile.
MT534 unc-93(e1500) dpy-17(e164) III. C. elegans DpyUnc. Semi-dominant Unc.
MT5353 ced-3(n1949) IV. C. elegans Strong allele of ced-9. Reference: (1999) Genetics 153(4):1655-71.
MT5439 sqt-3(sc8) unc-76(e911) V; lon-2(e678) xol-1(y70) X. C. elegans Roller. Long. Unc. XO Lethal. sc8 previously called rol-4(sc8).
MT5449 clr-1(e1745) II; let-60(n2021) IV. C. elegans Non-Lethal allele of let-60. Clear. Suppresses n765. Maintain at 15C.
MT5470 lin-37(n758) III. C. elegans WT. Muv with lin-8, lin-38 or lin-15(n767).
MT5475 aex-3(n2166) X. C. elegans
MT5491 nDf40 dpy-18(e364) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc-36, dead eggs and zygotic embryonic lethals (nDf40 dpy-18 homozygotes). Maintain by picking WT.
MT5492 nDf40 dpy-18(e364) III; ctDp6 (III;f). C. elegans Animals with ctDp6 are WT and throw WT and dead eggs.
MT5499 let-60(n1876) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Lethal twitchers and dead eggs.
MT5519 sup-9(n1550n2174) II; sup-10(n983) X. C. elegans Weak Rubberband.
MT5523 unc-69(e587) ced-9(n1950n2161)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.
MT555 lin-8(n111) dpy-10(e128) II. C. elegans Dpy.
MT556 dpy-17(e164) lin-9(n112) III. C. elegans Dpy.
MT5701 flr-4(n2259) X. C. elegans Con, Sup, Dec (temperature-sensitive). Reference: Mol Bio Cell (2005) 16:1355-65.
MT5726 dpy-20(e1362) unc-22(e66) IV; him-5(e1490) V; nDp5 (IV;f). C. elegans Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Twitchers. Throws both WT and DpyTwitcher males. Maintain by picking WT.
MT5729 dpy-20(e1282) unc-30(e191) ced-3(n717) IV. C. elegans Dpy (ts). Unc. Abnormal cell death. Cells that normally die survive.
MT573 dpy-1(e1) unc-93(e1500) III. C. elegans DpyUnc. e1500 is semi-dominant.
MT5734 nDf41 IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Unc. nDf41 is homozygous lethal. Throws dead eggs.
MT5748 let-60(n2022) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans
MT5749 let-60(n2034) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, Vul and dead eggs.
MT5750 let-60(n2035) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans
MT5788 nIs2 IV. C. elegans nIs2 [lin-11::lacZ + lin-11(+)] IV. WT phenotype. Integrated on IV near dpy-20. Derived from MT5759.
MT5797 lin-11(n389) I; nIs2 IV; lin-18(e620) X. C. elegans nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.
MT5798 lin-11(n389) I; lin-26(n156) II; nIs2 IV. C. elegans nIs2 [lin-11::lacZ + lin-11(+)] IV. Integrated on IV near dpy-20.
MT5811 ced-1(e1735) I; ced-3(n717) IV. C. elegans
MT5813 nDf42 V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs and dead eggs.
MT5816 ced-4(n2273) III. C. elegans Weak defects in protection and killing.
MT5823 lin-26(n156) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. C. elegans Heterozygotes are WT.
MT5825 sem-4(n1971) I. C. elegans Egl - Bag, Con. Strong allele of sem-4.
MT5828 lin-36(n766) unc-36(e251) III; lin-15A(n767) X. C. elegans Unc. Muv.
MT5851 ced-4(n2274) III. C. elegans
MT588 lin-31(n301) unc-4(e120) II. C. elegans Muv. Unc.
MT5884 sem-4(n1971) I; unc-49(e382) III. C. elegans Egl. Unc-shrinker.
MT5896 sup-9(n1550) II; unc-93(n2289) sup-18(n1014) III. C. elegans
MT5920 nP48 sup-9(n1330) II; unc-93(e1500) III. C. elegans Non-Unc phenotype.
MT5998 sem-5(n2195) X. C. elegans Suppresses clr-1(e1745) at 25 degrees. Reference: (1992) Nature 356:340-4.
MT6015 unc-93(n2334) dpy-17(e164) III; sup-10(n983) X. C. elegans n2334 suppresses n983. Dpy.
MT6025 lin-31(n301) II; dpy-9(e12) IV; unc-51(e369) V. C. elegans Mapping strain.
MT6034 lin-36(n766) III. C. elegans WT. Synthetic Muv with lin-8, lin-38 or lin-15(n767).
MT6160 unc-76(n2397) V. C. elegans Unc. Null allele of unc-76.
MT6161 unc-76(n2398) V. C. elegans Unc. Weak allele of unc-76.
MT6169 exc-4(n2400) I. C. elegans Exc canal outgrowth abnormal. PVul. Tail Vab.
MT6183 bli-3(e767) unc-54(e1092) I. C. elegans Mapping strain.
MT6184 unc-52(e444) II; unc-25(e156) dnj-17(ju1162) III; dpy-4(e1166) IV. C. elegans
MT6185 dpy-1(e1) III; unc-34(e566) V. C. elegans Mapping strain. Unc is ts.
MT6201 unc-47(n2409) III. C. elegans Unc.
MT6205 cha-1(n2411) IV. C. elegans Coiler.
MT6214 unc-25(n2379) III. C. elegans Con, Shk(ts). Weak allele of unc-25.
MT628 dpy-9(e12) unc-17(e245) IV. C. elegans Dpy. Unc.
MT6292 unc-76(n2457) V. C. elegans Unc.
MT6318 eat-4(n2474) III. C. elegans Osm. Nmec.
MT6322 sup-11(n710) I; sup-9(n1550) II. C. elegans Unc and Egl. Grows slowly.
MT633 lin-11(n389) I; him-5(e1467) V. C. elegans Vulvaless. Slightly Unc. Throws males.
MT6347 ced-3(n2433) IV. C. elegans n2433 is a suppressor of ced-9(n1950n2161).
MT6356 dpy-5(e61) nDf43/dpy-14(e188) unc-14(e57) I. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and animals which arrest as L1 or L2 larvae (nDf43) homozygotes.
MT6378 lin-45(n2506) let-60(n1046) IV. C. elegans n2506 suppresses n1046.
MT6490 unc-25(n2569) III. C. elegans Temperature sensitive. At 25C, constitutive shrinker. At 20C, non-shrinker constitutive weak.
MT6505 sem-4(n1378) I; unc-30(e165) IV. C. elegans
MT664 lin-8(n111) II; lin-15B(n374) X. C. elegans Synthetic Muv.
MT681 nDf3/lin-31(n301) bli-2(e768) II. C. elegans Hets are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. New stock received 9/15/97 from MT.
MT688 lin-12(n137)/unc-32(e189) III; him-5(e1467) V. C. elegans Heterozygotes are Muv and segregate Muv, Unc and males. Maintain by picking Muv which throw Uncs.
MT690 nDf6/unc-93(e1500) dpy-17(e164) III. C. elegans Heterozygotes are Unc (Rubberband) and segregate Unc, DpyUnc and early larval lethals (nDf6 homozygotes). Maintain by picking Unc non-Dpy.
MT6921 sem-4(n2654) I. C. elegans Aex. Con.
MT6923 egl-2(n2656) V. C. elegans Semi-dominant Egl. Semi-dominant Exp.
MT6924 ric-7(n2657) V. C. elegans
MT6940 dpy-20(e1282) IV; unc-76(e911) V. C. elegans Unc. Temperature sensitive Dpy.
MT697 nDf13/unc-93(e1500) dpy-17(e164) III. C. elegans Heterozygotes are Unc(Rubberband) and Egl, and segregate Unc, DpyUnc and dead eggs. Maintain by picking Unc.
MT699 nDf15/unc-93(e1500) dpy-17(e164) III. C. elegans Heterozygotes are Unc and segregate Unc, DpyUnc and dead eggs. Maintain by picking Unc.
MT6996 dpy-9(e12) ced-2(e1752) lin-1(e1275) IV. C. elegans Dpy. Temperature sensitive Muv. Abnormal cell death.
MT7019 ccar-1(n2667) IV. C. elegans Temperature sensitive.
MT7021 ccar-1(n2667) dpy-4(e1166) IV. C. elegans
MT7026 mek-2(n2679)/sup-11(n403) dpy-5(e61) I. C. elegans Heterozygotes are WT and segregate WT, steriles with a vulval defect, and scrawny Dpys. n2679 is a suppressor of let-60(n1046) Muv, and is recessive sterile with vulval defects. n267 is an intermediate strength allele. See also WBPaper00002150.
MT7052 lin-45(sy96) unc-24(e138) IV. C. elegans
MT706 lin-13(n388)/unc-32(e189) III. C. elegans Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, and Sterile Muv. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.
MT7169 sem-4(n1378) I; ced-5(n2098) ced-3(n2720) IV. C. elegans
MT7170 sem-4(n1378) I; ced-5(n2098) ced-3(n2719) IV. C. elegans
MT7195 lin-1(n757) IV. C. elegans Strong Muv.
MT7236 lin-39(n1760) egl-5(n945) III. C. elegans n1760: strong allele of lin-39, vulvaless (n300-like). n945: HSN-. Egl. Coiler.
MT7238 sma-3(e491) mab-5(e1239) egl-5(n945)/lin-39(n1760) mab-5(e1239) egl-5(n945) III. C. elegans
MT725 unc-93(e1500) III; sup-10(n183) X. C. elegans Non-Unc.
MT7255 lin-39(n1760) mab-5(e1239) egl-5(n945) III. C. elegans Small brood size. Semi-sterile. n945: HSN-. Egl. Coiler.
MT7386 ced-9(n2812) III; ced-3(n717) IV. C. elegans n2812 is a strong loss-of-function allele and a maternal effect lethal.
MT7419 lin-39(n1760) mab-5(e1239)/sma-3(e491) mab-5(e1239) III. C. elegans
MT7479 sqv-2(n2826) II. C. elegans Mid-L4 vulva abnormal. Somewhat sterile.
MT7480 sqv-8(n2825)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are somewhat sterile.
MT7482 sqv-3(n2823) III/eT1 (III;V). C. elegans Heterozygotes are WT and segregate WT, Unc-36, and Sqvs which have an abnormal vulva from mid-L4 and are sterile.
MT7483 sqv-8(n2822)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are sterile.
MT7502 sem-4(n1378) I; ced-5(n2098) ced-3(n2830) IV. C. elegans
MT7553 dpy-19(e1259) sqv-3(n2842)/eT1 III; +/eT1 V. C. elegans Heterozygotes are WT and segregate WT, DpySqv, Unc-36 and dead eggs.
MT7554 sqv-3(n2842) unc-69(e587)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and Sqv Uncs. n2842: mid-L4 vulva abnormal, sterile.
MT7556 sqv-3(n2842)/eT1 III; +/eT1 V. C. elegans Heterozygotes are WT and segregate WT, Sqv, Unc-36 and dead eggs.
MT7562 sqv-7(n2839) II. C. elegans Weak allele of sqv-7. mid-L4 vulva abnormal. Somewhat sterile.
MT7567 lin-1(sy254) IV. C. elegans Strong Muv. Null.
MT7594 lin-39(n1760) ncl-1(e1865) unc-36(e251) III; sDp3 (III;f). C. elegans Pick WT to maintain strain. Dp lost at high frequency, usable for mosaic analysis. Animals without the Dp are Unc, Vul and Ncl.
MT7620 lin-45(n2506) unc-24(e138)/bli-6(sc16) unc-24(e138) IV. C. elegans Heterozygotes are Unc and segregate Unc, UncVul, and BliUnc.
MT7626 let-7(n2853) X. C. elegans Temperature sensitive - maintain at 15C. Seam cells divide in L4-to-adult molt. Animals undergo extra molt and explode at vulva. Males have leptoderan-like tail. Animals explode or are sterile at 25C.
MT7632 ced-3(n2432) IV. C. elegans Suppressor of ced-9(n1950 n2162). Reference: (1999) Genetics 153(4):1655-71.
MT765 unc-93(e1500n224) III. C. elegans WT phenotype.
MT7677 nIs31. C. elegans nIs31 [mec-7::ced-4a + rol-6(su1006)]. Rollers.
MT7686 ced-9(n2812)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT. Segregates Dpy Steriles.
MT7735 ced-9(n2812) III; ced-3(n2427) IV. C. elegans
MT775 unc-93(e1500n234) III. C. elegans Wild type phenotype. e1500 rubberband phenotype is suppressed by the loss-of-function n234 mutation.
MT7988 bas-1(ad446) III. C. elegans [egl mutation (n1397) has been removed in this strain.]
MT8022 lin-1(n304) IV. C. elegans Strong Muv. Null.
MT814 unc-58(e665n273) X. C. elegans Revertant. WT.
MT8186 mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. C. elegans Heterozygotes are WT and segregate WT, Vul and DpyUncs. oz140 homozygotes are Vul and Sterile.
MT8189 lin-15B&lin-15A(n765) X. C. elegans Temperature sensitive Muv. At 15C males will mate.
MT8190 lin-15B&lin-15A(n765) nIs51 X. C. elegans nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.
MT8191 snt-1(md290) unc-104(e1265) II/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Unc, and paralyzed Dpy Uncs. Reference: Jorgensen EM, Nature. 1995 Nov 9;378(6553):196-9.
MT8256 lin-1(n304) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, Muvs and dead eggs.
MT8309 ced-3(n2921) IV. C. elegans Suppressor of ced-9(n1950n2161) maternal effect lethality.
MT831 unc-58(e665n290) X. C. elegans Revertant. Not paralysed, but still somewhat Unc.
MT8312 ced-3(n2877) IV. C. elegans Medium strong allele. Suppressor of ced-9(n1950n2161) maternal effect lethality.
MT8313 ced-3(n2885) IV. C. elegans Medium-strong alllele; suppresses of ced-9(n1950 n2162) maternal effect lethality. Reference: (1999) Genetics 153(4):1655-71.
MT8319 ced-3(n2888) IV. C. elegans Suppressor of ced-9(n1950n2161) maternal effect lethality. Strong allele of ced-3.
MT8347 ced-3(n2452) IV. C. elegans
MT8352 ced-3(n2439) IV. C. elegans Suppressor of ced-9(n1950n2161) maternal effect lethality.
MT8354 ced-3(n2454) IV. C. elegans n2454 is a strong allele of ced-3.
MT8384 lin-1(sy254) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, Muv and dead eggs.
MT8388 dpy-17(e164) mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. C. elegans Heterozygotes are Dpy and segregate Dpy, DpyUncs and DpyVulSterile. oz140 homozygotes are Vul and Sterile.
MT8457 lin-15B&lin-15A(n765) X; nIs60. C. elegans nIs60 [vab-3::GFP + lin-15(+)]. Animals are non-Muv.
MT8504 egl-10(md176) V. C. elegans Animals are Egl and show sluggish locomotion and foraging behavior. Null allele: egl-10 is deleted or severely rearranged, and EGL-10 protein is undetected by Western blotting and in situ staining of animals.
MT8536 nEx648. C. elegans nEx648 [hsp::unc-30 (PD 49-78 and PD 49.3) + rol-6(su1006)]. Pick Rollers to maintain.
MT8603 nIs70. C. elegans nIs70 [(pGS39) ced-8::GFP + rol-6(su1006)]. Rollers. Reference: Stanfield GM & Horvitz HR., Mol Cell. 2000 Mar;5(3):423-33.
MT862 lin-4(e912) II; lin-14(n360) X. C. elegans
MT8626 goa-1(n3055) I. C. elegans Defective slowing on bacteria. Reference: (2000) Neuron 26:619-31.
MT8666 mek-2(n1989) I. C. elegans Weak allele of mek-2. 95% of the animals are WT. See also WBPaper00002150.
MT8667 mek-2(n2678)/sup-11(n403) dpy-5(e61) I. C. elegans Heterozygotes are WT and segregate WT, Sterile Vuls and scrawny Dpys. n2678 is a suppressor of let-60(n1046) Muv. n2678 animals are Vul and recessive sterile. n2678 is a strong allele, probably null. See also WBPaper00002150.
MT8673 ksr-1(n2682) X. C. elegans Suppressor of let-60(n1046). Strongest allele. Homozygous viable.
MT8675 ksr-1(n2509) X. C. elegans Suppressor of n1046. Weak allele of ksr-1.
MT8677 ksr-1(n2526) X. C. elegans Suppressor of n1046. Strong allele.
MT8696 ced-3(n2449) IV. C. elegans n2449 is a weak allele of ced-3.
MT8699 ced-3(n2424) IV. C. elegans n2424 is a weak allele of ced-3.
MT8704 ces-1(n703n1434) I. C. elegans n1434 restores death of NSM and I2 sister. n703sd: multiple (3-4) NSMs.
MT8735 egl-1(n1084n3082) V. C. elegans n3082 is a semidominant suppressor of egl-1(n1084sd) Egl- phenotype. Recessive Ced- phenotype - average of 11 extra cells in anterior pharynx. n3082 is a loss of function allele.
MT8793 ced-5(n1812) IV; nuc-1(e1392) X. C. elegans n1812: dead cells persist, maternal rescue of embryonic.
MT8838 lin-13(n770) III. C. elegans synMuv class B.
MT8839 lin-52(n771) III. C. elegans synMuv class B.
MT8840 dpy-5(e61) lin-53(n833) I. C. elegans Dpy. n833 is a synthetic Muv with lin-15A(n767).
MT8841 lin-54(n2231) IV. C. elegans synMuv class B.
MT8842 lin-56(n2728) II. C. elegans synMuv class A.
MT8872 Panagrellus redivivus. Panagrellus redivivus Not hermaphroditic. Sexes separate. Growth slow. MT received from Rothamsted Experimental Station, Harpenden, Hertfordshire, England. See also WBPaper0000567.
MT8879 dpl-1(n2994) II. C. elegans Synthetic Muv B.
MT8886 ced-7(n2094) III. C. elegans Unengulfed cell corpses. Strong allele of ced-7.
MT8904 lin-17(n3091) I. C. elegans Mail tale abnormal. Bivulva.
MT8943 bas-1(ad446) III; cat-4(e1141) V. C. elegans Cat. Serotonin minus.
MT8944 mod-5(n822) I. C. elegans 5-HT loading defective.
MT8987 pag-3(n3098) X. C. elegans Kinker Unc, neuronal lineage defects including lineage reiterations and abnormal corpse pattern in ventral cord. Allele causes W113 opal.
MT8998 unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.
MT8999 unc-42(e270) sqv-4(n2827) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.
MT9056 nDf20 III; nDp2 [unc-86(e1416)] (III;f). C. elegans Segregates Unc-86 animals and dead eggs.
MT9088 sqv-7(n2844) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, UncSqv and DpyUncs. n2844: mid-L4 vulva abnormal, sterile.
MT912 sup-11(n403) I. C. elegans Dominant suppressor of unc-93(e1500), recessive small scrawny slow growing phenotype.
MT925 lin-14(n355n407) X. C. elegans
MT9258 ced-7(n2690) III. C. elegans
MT9343 lin-36(n766) III; lin-15A(n767) X; nIs93. C. elegans nIs93 [(pJHT27)lin-36p::GFP::lin-36 (full-length coding) + rol-6(su1006)]. Rollers. Non-Muv -- nearly completely penetrant rescue of Lin-36. Reference: Thomas & Horvitz (1999) Development 126(15):3449-59.
MT9352 sqv-6(n2845) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, Steriles and dead eggs. n2845: mid-L4 vulva abnormal, sterile.
MT9371 nIs50 IV. C. elegans nIs50 [mec-7::ced-3a + rol-6(su1006)]. Rollers.
MT9454 cup-5(n3194) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Sterile Dpys, and Mel Uncs. cup-5(n3194) is a Q139 ochre allele with a maternal effect lethal phenotype including accumulation of refractile bodies resembling apoptotic cells in some regards. cup-5 homozygotes are also defective in coelomocyte uptake.
MT9455 tbh-1(n3247) X. C. elegans n3247 is a 791 bp deletion which results in a truncated TBH-1 protein. Hypersensitive to 5-HT. Reduced locomotion rate.
MT947 unc-31(n422) IV. C. elegans Temperature sensitive egg laying defective. Retains late stage eggs. Paralyzed Unc.
MT9647 unc-29(e1072) sqv-5(n3039)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.
MT9668 mod-1(ok103) V. C. elegans Serotonin resistant. Recessive.
MT9772 mod-5(n3314) I. C. elegans Serotonin hypersensitive. Isolated as a 1688 bp deletion. Backcrossed 6 times using PCR as the assay to follow mutant chromosome. 5-HT hypersensitivity phenotype does segregate after 6 backcrosses. Hyperslowing in locomotion assay as well.
MT9828 unc-39(e257) V; lin-15B&lin-15A(n765) X. C. elegans
MT9830 unc-36(e251) III; dpy-20(e1282) IV; lin-15B&lin-15A(n765) X. C. elegans
MT990 lin-9(n112) III; lin-15A(n433) X. C. elegans Synthetic Muv. n433 is lin-15 Class A allele.
MT9926 efl-1(n3318)/unc-76(e911) dpy-21(e428) V. C. elegans Heterozygotes are WT and segregate WT, UncDpy and Mel. Received new stock from the Horvitz lab 5/04.
MT9940 dpl-1(n3316) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. n3316 is Mel. 1422 bp deletion removes cosmid T23G7 nt 5200-6621.
MT9958 ced-10(n3246) IV. C. elegans Unengulfed cell corpses.
MT9971 nIs107 III. C. elegans nIs107 [tbh-1::GFP + lin-15(+)] III. GFP expression in RIC. Reference: Alkema MJ, et al. Neuron. 2005 Apr 21;46(2):247-60.
NJ388 unc-76(rh116) V. C. elegans Unc. Loss-of-function or null allele.
NW424 unc-76(ev424) V. C. elegans Unc. Loss-of-function or null allele.
PS1403 lin-17(sy277) I. C. elegans Bivulva. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1289 mir-63(n4568) X. C. elegans Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1361 mir-2(n4108) I. C. elegans Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1362 mir-70(n4109) V. C. elegans Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
n765 Allele insertion frameshift
n2668 Allele
n566 Allele
n754 Allele
n719 Allele substitution splice_site
n1091 Allele substitution
n111 Allele substitution
n112 Allele substitution
n180 Allele substitution splice_site
n199 Allele
n2258 Allele substitution
n945 Allele
n301 Allele substitution
n2916 Allele substitution nonsense
n1086 Allele
n585 Allele substitution
n170 Allele
n1760 Allele substitution nonsense
n1213 Allele
n1936 Allele
n2150 Allele
n2145 Allele substitution
n1347 Allele
n1605 Allele
n2559 Allele
n2018 Allele substitution
n2618 Allele substitution
n582 Allele substitution
n2368 Allele substitution
n717 Allele substitution splice_site
n1353 Allele substitution
n484 Allele
n545 Allele substitution
n703 Allele substitution
n1892 Allele
n3192 Allele substitution nonsense
n3435 Allele deletion
n4275 Allele deletion
n696 Allele
n179 Allele substitution
n4640 Allele deletion
n102 Allele
n491 Allele substitution
n1792 Allele substitution nonsense
n678 Allele deletion
n309 Allele
n745 Allele substitution nonsense
n676 Allele substitution
n930 Allele
n655 Allele substitution
n1253 Allele substitution nonsense
n1829 Allele
n3091 Allele substitution nonsense
n671 Allele substitution nonsense
n1162 Allele substitution nonsense
n686 Allele substitution splice_site
n403 Allele
n941 Allele substitution
n886 Allele
n950 Allele substitution
n302 Allele substitution
n2372 Allele
n2373 Allele
n4899 Allele deletion
n4638 Allele deletion
n728 Allele
n398 Allele
n476 Allele deletion
n744 Allele substitution nonsense
n2461 Allele substitution
n1993 Allele substitution
n496 Allele
n1046 Allele substitution
n487 Allele
n431 Allele substitution nonsense
n432 Allele substitution
n137 Allele substitution
n460 Allele
n3366 Allele substitution
n833 Allele substitution
n767 Allele insertion
n3413 Allele substitution
n105 Allele substitution
n3421 Allele deletion
n2731 Allele substitution nonsense
n106 Allele substitution nonsense
n3420 Allele
n472 Allele
n473 Allele
n474 Allele deletion frameshift
n477 Allele insertion
n478 Allele substitution
n479 Allele substitution nonsense
n481 Allele substitution
n482 Allele
n483 Allele substitution
n3334 Allele deletion
n485 Allele
n486 Allele substitution
n488 Allele deletion
n492 Allele
n3417 Allele deletion
n494 Allele
n495 Allele
n498 Allele substitution
n501 Allele substitution
n506 Allele
n3611 Allele deletion
n499 Allele
n3261 Allele substitution nonsense
n3376 Allele substitution
n3643 Allele substitution nonsense
n3314 Allele
n3714 Allele substitution
n463 Allele
n529 Allele substitution
n355 Allele insertion
n534 Allele substitution nonsense
n536 Allele deletion
n540 Allele substitution nonsense
n3702 Allele substitution nonsense
n3400 Allele
n549 Allele
n3789 Allele deletion
n3701 Allele
n561 Allele
n570 Allele
n571 Allele substitution splice_site
n572 Allele
n573 Allele substitution nonsense
n575 Allele
n576 Allele substitution splice_site
n577 Allele
n578 Allele substitution
n3197 Allele
n586 Allele substitution nonsense
n587 Allele
n588 Allele substitution
n589 Allele substitution
n592 Allele substitution
n599 Allele
n601 Allele
n602 Allele
n3630 Allele substitution nonsense
n606 Allele
n611 Allele substitution nonsense
n612 Allele substitution
n3681 Allele substitution
n3809 Allele substitution nonsense
n2728 Allele deletion
n751 Allele substitution
n3447 Allele substitution
n4100 Allele deletion
n4101 Allele deletion
n4102 Allele deletion
n4104 Allele deletion
n4076 Allele deletion
n4077 Allele deletion
n4106 Allele deletion
n4110 Allele deletion
n4112 Allele deletion
n4113 Allele deletion
n4114 Allele deletion
n4115 Allele deletion
n4117 Allele deletion
n4130 Allele deletion
nDf52 Allele deletion
n3538 Allele substitution
n672 Allele
nDf47 Allele deletion
n3419 Allele
n4075 Allele deletion
n3441 Allele substitution nonsense
n4255 Allele deletion
n4256 Allele deletion
nDf49 Allele deletion
n4276 Allele deletion
n4280 Allele deletion
n677 Allele substitution nonsense
n4066 Allele deletion
n4289 Allele deletion
n4295 Allele deletion
n4097 Allele deletion
n4037 Allele deletion
n4296 Allele deletion
n4293 Allele deletion
nDf51 Allele deletion
n387 Allele
n679 Allele substitution
n4316 Allele deletion
nDf53 Allele deletion
n4330 Allele deletion
nDf54 Allele deletion
n4317 Allele
n4126 Allele deletion
n4108 Allele deletion
n4315 Allele deletion
nDf50 Allele deletion
n4337 Allele deletion
n4438 Allele deletion
n4426 Allele
n690 Allele substitution
n3536 Allele substitution
n691 Allele deletion frameshift
n4442 Allele deletion
n692 Allele substitution nonsense
n693 Allele
n4382 Allele deletion
n4472 Allele deletion
nDf56 Allele deletion
n694 Allele
n4473 Allele deletion
n4474 Allele deletion
n4475 Allele deletion
n695 Allele substitution
n4488 Allele deletion
n698 Allele substitution splice_site
n4503 Allele deletion
n4470 Allele deletion
n4520 Allele deletion
n4526 Allele deletion
n4534 Allele deletion
n4535 Allele deletion
n4540 Allele deletion
n4545 Allele deletion
n4331 Allele deletion
n4548 Allele deletion
n4562 Allele substitution nonsense
nDf58 Allele deletion
n4571 Allele deletion
n4589 Allele deletion
nDf59 Allele deletion
n4594 Allele deletion
n4595 Allele deletion
n4599 Allele
n4600 Allele deletion
n4601 Allele deletion
n4604 Allele deletion
n4605 Allele deletion
n4606 Allele deletion
n4622 Allele deletion
n150 Allele substitution
n4635 Allele deletion
nDf60 Allele deletion
n4636 Allele deletion
n4637 Allele deletion
n4639 Allele deletion
n4641 Allele deletion
n1306 Allele
n1315 Allele
n1318 Allele
n1319 Allele
n1320 Allele
n151 Allele
n3368 Allele deletion
n3423 Allele deletion
n709 Allele substitution
n152 Allele deletion
n715 Allele substitution splice_site
n716 Allele
nDf62 Allele deletion
n729 Allele
n730 Allele substitution nonsense
n742 Allele
n4759 Allele deletion
n4760 Allele
n155 Allele
n4761 Allele deletion
n156 Allele substitution
n4547 Allele deletion
n4775 Allele deletion
n475 Allele substitution nonsense
n4797 Allele deletion
n3294 Allele substitution
n569 Allele
n4541 Allele deletion
n4894 Allele deletion
n3297 Allele substitution
n4367 Allele deletion
nDf64 Allele deletion
n4909 Allele deletion
n162 Allele substitution nonsense
n4850 Allele substitution
n749 Allele substitution nonsense
n4570 Allele deletion
n4505 Allele deletion
n4286 Allele deletion
n4618 Allele deletion
n4607 Allele deletion
n4798 Allele deletion
n758 Allele substitution splice_site
n4949 Allele deletion
n766 Allele substitution nonsense
n4947 Allele deletion
n4588 Allele substitution
n773 Allele
n776 Allele
n777 Allele substitution
n493 Allele substitution
n4471 Allele deletion
n490 Allele
n821 Allele
n785 Allele
n4983 Allele deletion
n786 Allele
n171 Allele
n5017 Allele deletion
nDf67 Allele deletion
n718 Allele substitution
n4539 Allele deletion
n5021 Allele deletion
n176 Allele substitution nonsense
n316 Allele substitution splice_site
n4504 Allele deletion
n4568 Allele deletion
n838 Allele substitution
n360 Allele
n727 Allele substitution
n843 Allele
n844 Allele
n845 Allele
n846 Allele
n847 Allele
n848 Allele substitution splice_site
n5223 Allele deletion
n904 Allele substitution
n946 Allele
n200 Allele
n5357 Allele substitution nonsense
n947 Allele
n5418 Allele deletion
n952 Allele substitution
n5453 Allele deletion
n983 Allele
n987 Allele
n995 Allele
n996 Allele
n999 Allele
n1043 Allele substitution
n1045 Allele substitution splice_site
n1047 Allele substitution
n1051 Allele substitution nonsense
n1053 Allele substitution nonsense
n1058 Allele substitution splice_site
n4065 Allele
n1075 Allele
n1076 Allele
n1077 Allele substitution
n1079 Allele
n1080 Allele
n1081 Allele substitution
n1084 Allele
n1089 Allele deletion
n1106 Allele
n1107 Allele
n1108 Allele
n1119 Allele
n1226 Allele
n1127 Allele substitution splice_site
n1082 Allele substitution
n720 Allele
n382 Allele
n1130 Allele substitution
n1134 Allele substitution
n500 Allele substitution
n1165 Allele substitution nonsense
n1171 Allele
n1172 Allele
n1173 Allele
n1179 Allele
n1186 Allele substitution nonsense
n1190 Allele
n1192 Allele
n1193 Allele
n1194 Allele
n1197 Allele
n1198 Allele
n1195 Allele
n1196 Allele
n1199 Allele
n1201 Allele
n1204 Allele
n1211 Allele
n1214 Allele
n986 Allele
n1270 Allele substitution nonsense
n1273 Allele
n1274 Allele
n1279 Allele
n1258 Allele substitution
n1260 Allele
n997 Allele
n1321 Allele
n1304 Allele
n1305 Allele
n1313 Allele
n1314 Allele
n1316 Allele
n1317 Allele
n1299 Allele deletion
n1326 Allele
n1259 Allele
n1254 Allele
n1286 Allele substitution nonsense
n303 Allele substitution
n306 Allele
n308 Allele
n1338 Allele
n1324 Transposon insertion
n1345 Allele
n1346 Allele
n1354 Allele
n1332 Allele
n1378 Allele
n318 Allele
n1377 Allele
n1343 Transposon insertion insertion
n1386 Allele
n1387 Allele
n1390 Allele substitution
n324 Allele substitution nonsense
n1402 Allele substitution nonsense
n1412 Allele
n1415 Allele
n1416 Allele
n1419 Allele
n333 Allele
n1458 Allele substitution
n1477 Allele substitution nonsense
n1457 Allele substitution nonsense
n1454 Allele substitution nonsense
n1014 Allele
n1438 Allele deletion
n1513 Allele
n1515 Allele substitution
n1518 Allele
n1520 Allele
n1435 Allele
n1506 Allele
n363 Allele
n1545
n1511 Allele substitution nonsense
n1602 Allele
n1604 Allele substitution
n1606 Allele substitution nonsense
n1550 Allele substitution
n1600 Allele
n372 Allele
n1540 Allele
n378 Allele substitution
n383 Allele substitution nonsense
n1630 Transposon insertion insertion
n1655 Allele
n1610 Allele
n1722 Allele substitution
n1652 Allele
n397 Allele
n1653 Allele substitution
n1654 Allele
n1759 Allele
n1774 Allele substitution splice_site
n1779 Allele substitution
n1783 Allele substitution
n1789 Allele substitution nonsense
n1490 Allele substitution splice_site
n1853 Allele substitution nonsense
n1812 Allele substitution nonsense
n1813 Allele deletion frameshift
n1872 Allele substitution splice_site
n1880 Allele substitution nonsense
n1912 Allele
n1531 Allele substitution
n1059 Allele substitution
n1700 Allele substitution
n1992 Allele
n2019 Allele substitution splice_site
n1950 Allele substitution
n2046 Allele
n2031 Allele
n2021 Allele substitution
n1281 Allele
n1995 Allele substitution
n2089 Allele substitution
n1994 Allele substitution nonsense
n2002 Allele
n2095 Allele
n1996 Allele substitution nonsense
n1997 Allele substitution
n1891 Allele
n1999 Allele
n732 Allele
n2110 Allele substitution
n1040 Allele substitution
n2030 Allele substitution splice_site
n2010 Allele substitution splice_site
n1894 Allele
n2144 Allele
n942 Allele substitution nonsense
n943 Allele substitution nonsense
n1949 Allele substitution nonsense
n2166 Allele
n1876 Allele substitution
n2174 Allele substitution splice_site
n2161 Allele substitution splice_site
n2202 Allele substitution
n2210 Allele substitution
n2259 Allele substitution
n2022 Allele substitution splice_site
n2034 Allele substitution
n2035 Allele substitution
n389 Allele
n2273 Allele
n1971 Allele
n2274 Allele
n2289 Allele
n1330 Allele
n2195 Allele substitution
n2334 Allele
n2397 Allele substitution nonsense
n2398 Allele substitution nonsense
n2400 Allele
n2409 Allele substitution
n2411 Allele
n2379 Allele substitution
n2457 Allele insertion splice_site
n2474 Allele
n710 Allele
n2433 Allele substitution
n2506 Allele substitution
n2527 Allele substitution nonsense
n2528 Allele
n2569 Allele substitution
n2561 Allele
n374 Allele
n2654 Allele substitution
n2656 Allele
n2657 Allele substitution
n2665 Allele insertion frameshift
n2669 Allele substitution nonsense
n2667 Allele
n2679 Allele substitution
n388 Allele substitution
n2098 Allele
n2720 Allele substitution
n2719 Allele substitution
n757 Allele substitution nonsense
n183 Allele deletion
n2812 Allele substitution nonsense
n2826 Allele substitution
n2825 Allele
n2823 Allele
n2822 Allele substitution nonsense
n2830 Allele substitution
n2835 Allele
n2842 Allele
n2839 Allele substitution
n2853 Allele substitution
n2432 Allele substitution
n224 Allele
n2427 Allele substitution
n234 Allele
n2914 Allele
n1761 Allele substitution splice_site
n2813 Allele
n304 Allele
n273 Allele
n2921 Allele substitution
n290 Allele
n2877 Allele substitution
n2885 Allele substitution
n2888 Allele substitution nonsense
n2452 Allele insertion
n2439 Allele substitution
n2454 Allele substitution
n3055 Allele
n1989 Allele substitution
n2678 Allele substitution
n2682 Allele substitution nonsense
n2509 Allele substitution
n2526 Allele substitution nonsense
n2449 Allele substitution
n2424 Allele substitution
n1434 Allele substitution nonsense
n3082 Allele
n770 Allele substitution nonsense
n771 Allele substitution
n2231 Allele substitution
n2994 Allele substitution splice_site
n2094 Allele substitution nonsense
n822 Allele substitution nonsense
n3098 Allele substitution nonsense
n2819 Allele substitution
n2827 Allele substitution
n2844 Allele substitution
n407 Allele
n2690 Allele substitution splice_site
n2845 Allele substitution nonsense
n3194 Allele substitution nonsense
n3247 Allele deletion
n422 Allele
n3039 Allele substitution nonsense
n433 Allele substitution
n3318 Allele deletion
n3316 Allele deletion
n3246 Allele substitution
n1619 Allele substitution
n1456 Allele substitution nonsense
n2415 Allele substitution
n1329 Transposon insertion insertion
n2521 Allele
n408 Allele
n3070 Allele substitution
n3066 Allele substitution nonsense
n3064 Allele substitution
n4357 Allele deletion
n4358 Allele deletion
n434 Allele substitution
n1012 Allele substitution nonsense
n1020 Allele substitution
n4109 Allele deletion
n546 Allele substitution nonsense
n3169 Allele substitution nonsense
n1790 Allele substitution nonsense
n1924 Allele substitution
n2515 Allele substitution
n2520 Allele substitution
n1925 Allele substitution
n2510 Allele substitution nonsense
n3263 Allele substitution