Variation Information: ax2055

Nameax2055 View on WormBase
Species C. elegans
Genetic positionIV:4.53 +/- 0.000 cM
Genomic positiongenomic coordinates unknown or not listed
Protein change Insertion

Strains carrying this variation

Strain Genotype Species Description
JH3199 gtbp-1(ax2055[gtbp-1::GFP]) IV. C. elegans Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.