Variation Information: ax2035
| Name | ax2035 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | IV:4.53 +/- 0.000 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | Insertion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JH3182 | gtbp-1(ax2035[gtbp-1::TetraCys]) IV. | C. elegans | Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23. |