Variation Information: tm678

Nametm678 View on WormBase
Species C. elegans
Genetic positionI:-1.02 +/- 0.002 cM
Genomic positionI: 4670370..4671042
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
IG256 xnp-1(tm678) I. C. elegans Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.