Laboratory Information
| Name | IG View on WormBase |
|---|---|
| Allele designation | fr |
| Head | Jonathan J Ewbank |
| Institution | Centre d'Immunologie, Marseille, France |
| Address | Centre d'Immunologie de Marseille Luminy Campus de Luminy 163 avenue de Luminy Marseille 13009 France |
| Website | http://www.ciml.univ-mrs.fr/science/lab-jonathan-ewbank/beginners |
| Gene classes | bmy cnc fip fipr grsp lact lys nipi smf tir hipi peni |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CB4567 | unc-53(e2432) II. | C. elegans | Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration. |
| Db10 | Serratia marcescens. | Serratia marcescens | Bacteria. Former CGC designation IGX1. Tetracycline resistant. A non-pigmented strain of Serratia marcescens isolated from moribund Drosophila flies. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. References: Kurz CL, et al. EMBO J. 2003 Apr 1;22(7):1451-60. J. Gen. Microbiol. 1980; 120: 173-181. Biosafety Level: BSL-1. |
| Db11 | Serratia marcescens. | Serratia marcescens | Bacteria. Former CGC designation IGX2. Tetracycline, streptomycin and kanamycin resistant. A spontaneous mutant resistant to streptomycin isolated from Db10. Serratia marcescens is a Gram-negative bacterium with a broad host range. S. marcescens is an opportunistic human pathogen and kills C. elegans upon colonization of the nematode intestine. Strain Db11 is a non-pigmented strain that is used to infect the nematode Caenorhabditis elegans in an infection-based model for studying host-pathogen interactions. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. CGC #5819. References: Kurz CL, et al. EMBO J. 2003 Apr 1;22(7):1451-60. Iguchi A, et al. Genome Biol Evol. 2014 Aug;6(8):2096-110. J. Gen. Microbiol. 1980; 120: 173-181. Biosafety Level: BSL-1. |
| Db1140 | Serratia marcescens. | Serratia marcescens | Bacteria. Former CGC designation IGX3. Tetracycline, streptomycin and kanamycin resistant. A protease-deficient mutant derived from Db11. See Flyg C, Xanthopoulos KG: Insect pathogenic properties of Serratia marcescens. Passive and active resistance to insect immunity studied with protease-deficient and phage-resistant mutants. References: Kurz CL, et al. EMBO J. 2003 Apr 1;22(7):1451-60. J. Gen. Microbio. 1983; 129: 453-464. Biosafety Level: BSL-1. |
| IG10 | tol-1(nr2033) I. | C. elegans | Healthy and fertile but exhibit a lowly penetrant lethality, and a small but significant proportion of the mutants arrest as early larvae. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21. |
| IG1107 | sta-2(fr67) V; frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887. |
| IG1110 | snf-12(fr70) X; frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887. |
| IG1114 | snf-12(fr74) X; frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887. |
| IG113 | frP1 III. | C. elegans | Mos1 transposon insertion: F28F5 (at position 1023) acacctggtaCTCACCCCTGTTTAACACACAGTCTTCACA. Mos1 sequence is in lowercase. |
| IG114 | frP2 III. | C. elegans | Mos1 transposon insertion: T28A8 (at position 2841) acacctggtaTTAAGAAAAAAACCGAGTCCTCTCACCGTA. Mos1 sequence is in lowercase. |
| IG115 | frP3 V. | C. elegans | Mos1 transposon insertion: CO8D8 (at position 17534) acacctggtaATAAAAGAAGGAAAAATAAATATTTAAGTT. Mos1 sequence is in lowercase. |
| IG117 | frP41 IV. | C. elegans | Mos1 transposon insertion: Y38C1AB (at position 8906) acacctggtaCAACTGGTTTAGAATAATTTAGAAATTACAA. Mos1 sequence is in lowercase. |
| IG118 | frP5 V. | C. elegans | Mos1 transposon insertion: F57F4 (at position 15459) acacctggtaGTCTCTTCAAGGAAGAACAATGAGAAATAA. Mos1 sequence is in lowercase. |
| IG119 | frP7 IV; frP6 X. | C. elegans | Mos1 transposon insertion: frP6: F39H12 (at position 19268) acacctggtaAGCATAGGGCTAGGCCTTAGACTTTATATT, and frP7: Y10G11A (at position 1294) acacctggtaAAACAATTTCCAAGTAAAAAAATCATGTATT. Mos1 sequence is in lowercase. |
| IG122 | frP8 frP9 III. | C. elegans | Mos1 transposon insertion: frP8: H14A12 (at position 9047) acacctggtaTACAATTTTGATTTCAGAAAGTTCTCTGAC, and frP9: Y45F3A (at position 220) acacctggtaGAATTGTTCGAACAAGCTTCAACGAGAAAGCAA. Mos1 sequence is in lowercase. |
| IG123 | frP10 X. | C. elegans | Mos1 transposon insertion: B0272 (at position 11068) acacctggtaTATGAGAAAATCTATAGCAAGTACATATCT. Mos1 sequence is in lowercase. |
| IG124 | frP11 I; frP13 II; frP14 III; frP12 X. | C. elegans | Mos1 transposon insertions: frP11: F31C3 (at position 26364) acacctggtaTCGGAGGAGCTGCCAAATGGCGTCCGACTT. frP12: F01E11 (at position 3748) acacctggtaCAATCGAAAATCATTGAAATCAGTTAACAG. frP13: Y38E10A (at position 40384) acacctggtaTAGCTAGAGGACTGTCCCGGTCTAAAATGA. frP14: F53A2 (at position 34332) acacctggtaTATTATAAAAGATGTATGAAATGTCGTGAA. Mos1 sequence is in lowercase. |
| IG1241 | sta-2(ok1860) V. | C. elegans | Strain derived by outcrossing RB1547 two times to N2 to remove the lethal background mutation in RB1547. Reference: Dierking K, et al. Cell Host Microbe. 2011 May 19;9(5):425-35. |
| IG125 | frP15 IV. | C. elegans | Mos1 transposon insertion: Y97E10B (at position 1022) acacctggtaAAACATGCTGAAAGTTTACTAAAATTGAAT. Mos1 sequence is in lowercase. |
| IG126 | frP16 III. | C. elegans | Mos1 transposon insertion: Y39A3CL (at position 24032) acacctggtaTATCGAAAAAAAATTTTTTTTTGGAATTTT. Mos1 sequence is in lowercase. |
| IG127 | frP17 IV. | C. elegans | Mos1 transposon insertion: K07H8 (at position 8196) acacctggtaTTATCAAAGTTAGAATTCAAACTGCGTTGC. Mos1 sequence is in lowercase. |
| IG128 | frP20 frP19 II; frP18 V. | C. elegans | Mos1 transposon insertions: frP18: K03H4 (at position 19156) acacctggtaGAATGGATGAGGTTGAAAGTGACGAAGAAAA. frP19: F35H8 (at position 15891) acacctggtaGTTTACTCATATTTCTTTCCTCTCTTCTTC. frP20: T14B4 (at position 25648) acacctggtaTGCAAATATGGTTAATGTAAGGCATTTTTG. Mos1 sequence is in lowercase. |
| IG129 | frP21 IV. | C. elegans | Dumpy. Mos1 transposon insertion: F30B5 (at position 22345) (dpy-13) acacctggtaGTTGTAGACGATTGGAAGAGTAATGCAAAC. Mos1 sequence is in lowercase. |
| IG130 | tol-1(nr2013) I. | C. elegans | Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21. |
| IG1335 | frEx479. | C. elegans | frEx479 [F57F4.4p::GFP + col-12p::DsRed]. Pick DsRed+ animals to maintain array. Constitutive GFP expression in posterior intestinal cells induced upon infection with Photorhabdus luminescens in posterior intestinal cells. Reference: Julien-Gau I, et al. Dev Comp Immunol. 2014 Feb;42(2):132-7. |
| IG1352 | nipi-4(fr71) V; frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887. |
| IG256 | xnp-1(tm678) I. | C. elegans | Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59. |
| IG274 | frIs7. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. |
| IG339 | tpa-1(fr1) frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52. |
| IG341 | tpa-1(fr3) frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52. |
| IG342 | frIs7 IV; nipi-3(fr4) X. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. |
| IG348 | fasn-1(fr8) I; frIs7 IV. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22. |
| IG358 | oxEx229. | C. elegans | oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482. |
| IG444 | frEx113. | C. elegans | frEx113 [(pJL44) transposase + col-12p::DsRed]. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482. |
| IG544 | nipi-3(fr4) X. | C. elegans | Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. |
| IG6 | smf-1(eh5) X. | C. elegans | No phenotype. Contains a 2063 bp deletion in the smf-1 locus (K11G12.4) from position 17016 to position 19079 on the K11G12 cosmid. eh5 was obtained from the Sanger Centre Knockout Service in strain HX104. Reference: Au C, et al. PLoS One. 2009 Nov 18;4(11):e7792. |
| IG685 | tir-1(tm3036) III. | C. elegans | Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105. |
| IG692 | tir-1(tm3036) III; frIs7. | C. elegans | frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105. |
| IGX1 | Serratia marcescens. | Serratia marcescens | Db10. Tetracyclin resistant. A non-pigmented strain of Serratia marcescens isolated from moribund Drosophila flies. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181. |
| IGX2 | Serratia marcescens | Serratia marcescens | Db11. Tetracyclin, streptomycin and kanamycin resistant. A spontaneous mutant resistant to streptomycin isolated from Db10. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181. |
| IGX3 | Serratia marcescens | Serratia marcescens | Db1140. Tetracyclin, streptomycin and kanamycin resistant. A protease-deficient mutant derived from Db11. See Flyg C, Xanthopoulos KG: Insect pathogenic properties of Serratia marcescens. Passive and active resistance to insect immunity studied with protease-deficient and phage-resistant mutants. J. Gen. Microbio. 1983; 129: 453-464. |
| MT152 | unc-53(n152) II. | C. elegans | Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration. See also WBPaper00005353. |
| NS2937 | trf-1(nr2014) III. | C. elegans | No obvious phenotype. |
| NS3026 | ikb-1(nr2027) I. | C. elegans | No obvious phenotype. |
| OP50-GFP | E. coli. | Escherichia coli | Bacteria. A strain of OP50 that contains a GFP plasmid (pFPV25.1) that is very fluorescent. Resistant to ampicillin. Originally published in Caenorhabditis elegans is a model host for Salmonella typhimurium. Labrousse A, Chauvet S, Couillault C, Kurz C, Ewbank J. Curr Biol. 2000 Nov 30;10(23):1543-5. |
| PD4482 | lmp-1(nr2045). | C. elegans | Deletion that spans exons 1-3 (out of 4) and is presumed to be a null. Under EM, one type of intestinal granule is missing. Missing type is not acidic, and does not stain with nile red. Under DIC, gut is lighter and the granules are not as densely packed. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| fr67 | |||
| fr70 | |||
| fr74 | |||
| fr71 | Allele | substitution | |
| fr1 | Allele | substitution | nonsense |
| fr3 | Allele | substitution | nonsense |
| fr4 | Allele | substitution | |
| fr8 | Allele | substitution |