Laboratory Information

NameIG View on WormBase
Allele designationfr
HeadJonathan J Ewbank
InstitutionCentre d'Immunologie, Marseille, France
Address Centre d'Immunologie de Marseille Luminy
Campus de Luminy
163 avenue de Luminy
Marseille 13009
France
Website http://www.ciml.univ-mrs.fr/science/lab-jonathan-ewbank/beginners
Gene classes bmy  cnc  fip  fipr  grsp  lact  lys  nipi  smf  tir  hipi  peni 

Strains contributed by this laboratory

Strain Genotype Species Description
CB4567 unc-53(e2432) II. C. elegans Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration.
Db10 Serratia marcescens. Serratia marcescens Bacteria. Former CGC designation IGX1. Tetracycline resistant. A non-pigmented strain of Serratia marcescens isolated from moribund Drosophila flies. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. References: Kurz CL, et al. EMBO J. 2003 Apr 1;22(7):1451-60. J. Gen. Microbiol. 1980; 120: 173-181. Biosafety Level: BSL-1.
Db11 Serratia marcescens. Serratia marcescens Bacteria. Former CGC designation IGX2. Tetracycline, streptomycin and kanamycin resistant. A spontaneous mutant resistant to streptomycin isolated from Db10. Serratia marcescens is a Gram-negative bacterium with a broad host range. S. marcescens is an opportunistic human pathogen and kills C. elegans upon colonization of the nematode intestine. Strain Db11 is a non-pigmented strain that is used to infect the nematode Caenorhabditis elegans in an infection-based model for studying host-pathogen interactions. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. CGC #5819. References: Kurz CL, et al. EMBO J. 2003 Apr 1;22(7):1451-60. Iguchi A, et al. Genome Biol Evol. 2014 Aug;6(8):2096-110. J. Gen. Microbiol. 1980; 120: 173-181. Biosafety Level: BSL-1.
Db1140 Serratia marcescens. Serratia marcescens Bacteria. Former CGC designation IGX3. Tetracycline, streptomycin and kanamycin resistant. A protease-deficient mutant derived from Db11. See Flyg C, Xanthopoulos KG: Insect pathogenic properties of Serratia marcescens. Passive and active resistance to insect immunity studied with protease-deficient and phage-resistant mutants. References: Kurz CL, et al. EMBO J. 2003 Apr 1;22(7):1451-60. J. Gen. Microbio. 1983; 129: 453-464. Biosafety Level: BSL-1.
IG10 tol-1(nr2033) I. C. elegans Healthy and fertile but exhibit a lowly penetrant lethality, and a small but significant proportion of the mutants arrest as early larvae. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.
IG1107 sta-2(fr67) V; frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1110 snf-12(fr70) X; frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG1114 snf-12(fr74) X; frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG113 frP1 III. C. elegans Mos1 transposon insertion: F28F5 (at position 1023) acacctggtaCTCACCCCTGTTTAACACACAGTCTTCACA. Mos1 sequence is in lowercase.
IG114 frP2 III. C. elegans Mos1 transposon insertion: T28A8 (at position 2841) acacctggtaTTAAGAAAAAAACCGAGTCCTCTCACCGTA. Mos1 sequence is in lowercase.
IG115 frP3 V. C. elegans Mos1 transposon insertion: CO8D8 (at position 17534) acacctggtaATAAAAGAAGGAAAAATAAATATTTAAGTT. Mos1 sequence is in lowercase.
IG117 frP41 IV. C. elegans Mos1 transposon insertion: Y38C1AB (at position 8906) acacctggtaCAACTGGTTTAGAATAATTTAGAAATTACAA. Mos1 sequence is in lowercase.
IG118 frP5 V. C. elegans Mos1 transposon insertion: F57F4 (at position 15459) acacctggtaGTCTCTTCAAGGAAGAACAATGAGAAATAA. Mos1 sequence is in lowercase.
IG119 frP7 IV; frP6 X. C. elegans Mos1 transposon insertion: frP6: F39H12 (at position 19268) acacctggtaAGCATAGGGCTAGGCCTTAGACTTTATATT, and frP7: Y10G11A (at position 1294) acacctggtaAAACAATTTCCAAGTAAAAAAATCATGTATT. Mos1 sequence is in lowercase.
IG122 frP8 frP9 III. C. elegans Mos1 transposon insertion: frP8: H14A12 (at position 9047) acacctggtaTACAATTTTGATTTCAGAAAGTTCTCTGAC, and frP9: Y45F3A (at position 220) acacctggtaGAATTGTTCGAACAAGCTTCAACGAGAAAGCAA. Mos1 sequence is in lowercase.
IG123 frP10 X. C. elegans Mos1 transposon insertion: B0272 (at position 11068) acacctggtaTATGAGAAAATCTATAGCAAGTACATATCT. Mos1 sequence is in lowercase.
IG124 frP11 I; frP13 II; frP14 III; frP12 X. C. elegans Mos1 transposon insertions: frP11: F31C3 (at position 26364) acacctggtaTCGGAGGAGCTGCCAAATGGCGTCCGACTT. frP12: F01E11 (at position 3748) acacctggtaCAATCGAAAATCATTGAAATCAGTTAACAG. frP13: Y38E10A (at position 40384) acacctggtaTAGCTAGAGGACTGTCCCGGTCTAAAATGA. frP14: F53A2 (at position 34332) acacctggtaTATTATAAAAGATGTATGAAATGTCGTGAA. Mos1 sequence is in lowercase.
IG1241 sta-2(ok1860) V. C. elegans Strain derived by outcrossing RB1547 two times to N2 to remove the lethal background mutation in RB1547. Reference: Dierking K, et al. Cell Host Microbe. 2011 May 19;9(5):425-35.
IG125 frP15 IV. C. elegans Mos1 transposon insertion: Y97E10B (at position 1022) acacctggtaAAACATGCTGAAAGTTTACTAAAATTGAAT. Mos1 sequence is in lowercase.
IG126 frP16 III. C. elegans Mos1 transposon insertion: Y39A3CL (at position 24032) acacctggtaTATCGAAAAAAAATTTTTTTTTGGAATTTT. Mos1 sequence is in lowercase.
IG127 frP17 IV. C. elegans Mos1 transposon insertion: K07H8 (at position 8196) acacctggtaTTATCAAAGTTAGAATTCAAACTGCGTTGC. Mos1 sequence is in lowercase.
IG128 frP20 frP19 II; frP18 V. C. elegans Mos1 transposon insertions: frP18: K03H4 (at position 19156) acacctggtaGAATGGATGAGGTTGAAAGTGACGAAGAAAA. frP19: F35H8 (at position 15891) acacctggtaGTTTACTCATATTTCTTTCCTCTCTTCTTC. frP20: T14B4 (at position 25648) acacctggtaTGCAAATATGGTTAATGTAAGGCATTTTTG. Mos1 sequence is in lowercase.
IG129 frP21 IV. C. elegans Dumpy. Mos1 transposon insertion: F30B5 (at position 22345) (dpy-13) acacctggtaGTTGTAGACGATTGGAAGAGTAATGCAAAC. Mos1 sequence is in lowercase.
IG130 tol-1(nr2013) I. C. elegans Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.
IG1335 frEx479. C. elegans frEx479 [F57F4.4p::GFP + col-12p::DsRed]. Pick DsRed+ animals to maintain array. Constitutive GFP expression in posterior intestinal cells induced upon infection with Photorhabdus luminescens in posterior intestinal cells. Reference: Julien-Gau I, et al. Dev Comp Immunol. 2014 Feb;42(2):132-7.
IG1352 nipi-4(fr71) V; frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
IG256 xnp-1(tm678) I. C. elegans Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.
IG274 frIs7. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. The nlp-29p::GFP reporter is induced in the epidermis upon infection with Drechmeria coniospora, wounding and osmotic stress. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG339 tpa-1(fr1) frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
IG341 tpa-1(fr3) frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.
IG342 frIs7 IV; nipi-3(fr4) X. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG348 fasn-1(fr8) I; frIs7 IV. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Constitutive expression of antimicrobial peptide nlp-29. Maintain under normal conditions. Reference: Lee KZ, et al. Virulence. 2010 May-Jun;1(3):113-22.
IG358 oxEx229. C. elegans oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
IG444 frEx113. C. elegans frEx113 [(pJL44) transposase + col-12p::DsRed]. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
IG544 nipi-3(fr4) X. C. elegans Slo, Sma, and Dpy at 25C. Reference: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9.
IG6 smf-1(eh5) X. C. elegans No phenotype. Contains a 2063 bp deletion in the smf-1 locus (K11G12.4) from position 17016 to position 19079 on the K11G12 cosmid. eh5 was obtained from the Sanger Centre Knockout Service in strain HX104. Reference: Au C, et al. PLoS One. 2009 Nov 18;4(11):e7792.
IG685 tir-1(tm3036) III. C. elegans Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.
IG692 tir-1(tm3036) III; frIs7. C. elegans frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.
IGX1 Serratia marcescens. Serratia marcescens Db10. Tetracyclin resistant. A non-pigmented strain of Serratia marcescens isolated from moribund Drosophila flies. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181.
IGX2 Serratia marcescens Serratia marcescens Db11. Tetracyclin, streptomycin and kanamycin resistant. A spontaneous mutant resistant to streptomycin isolated from Db10. See Flyg, Kenne K, Boman HG: Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and a decreased virulence to Drosophila. J. Gen. Microbiol. 1980; 120: 173-181.
IGX3 Serratia marcescens Serratia marcescens Db1140. Tetracyclin, streptomycin and kanamycin resistant. A protease-deficient mutant derived from Db11. See Flyg C, Xanthopoulos KG: Insect pathogenic properties of Serratia marcescens. Passive and active resistance to insect immunity studied with protease-deficient and phage-resistant mutants. J. Gen. Microbio. 1983; 129: 453-464.
MT152 unc-53(n152) II. C. elegans Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration. See also WBPaper00005353.
NS2937 trf-1(nr2014) III. C. elegans No obvious phenotype.
NS3026 ikb-1(nr2027) I. C. elegans No obvious phenotype.
OP50-GFP E. coli. Escherichia coli Bacteria. A strain of OP50 that contains a GFP plasmid (pFPV25.1) that is very fluorescent. Resistant to ampicillin. Originally published in Caenorhabditis elegans is a model host for Salmonella typhimurium. Labrousse A, Chauvet S, Couillault C, Kurz C, Ewbank J. Curr Biol. 2000 Nov 30;10(23):1543-5.
PD4482 lmp-1(nr2045). C. elegans Deletion that spans exons 1-3 (out of 4) and is presumed to be a null. Under EM, one type of intestinal granule is missing. Missing type is not acidic, and does not stain with nile red. Under DIC, gut is lighter and the granules are not as densely packed.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
fr67
fr70
fr74
fr71 Allele substitution
fr1 Allele substitution nonsense
fr3 Allele substitution nonsense
fr4 Allele substitution
fr8 Allele substitution