| AMJ345 |
jamSi2 II; rde-1(ne219) V. |
jamSi2 [mex-5p::rde-1(+)] II. mex-5p::rde-1(+) inserted into ttTi5605 on LG II. Tissue-specific RNAi rescue allows silencing in germline and intestine. Reference: Marre JA, et al. Proc Natl Acad Sci USA. 2016. |
| BB23 |
adr-1(gv6) I; adr-2(gv42) III; rde-1(ne219) V. |
RNAi deficient. Maintain under normal conditions. Reference: Tonkin LA & BassBL. Science. 2003 Dec 5;302(5651):1725. Knight SW & Bass BL. Mol Cell. 2002 Oct;10(4):809-17. |
| BB242 |
adr-1(uu49) I; adr-2(uu28) III; rde-1(uu51) V. |
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. |
| BB270 |
adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; rde-1(uu51) V. |
RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. |
| DCL569 |
mkcSi13 II; rde-1(mkc36) V. |
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans." |
| IG1839 |
frSi17 II; frIs7 IV; rde-1(ne300) V. |
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| IG1846 |
frSi21 II; frIs7 IV; rde-1(ne300) V. |
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454 |
| JK4143 |
qIs57 II; rde-1(ne219) V; qIs140. |
qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JU2039 |
mfIs70 IV; rde-1(ne219) V. |
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75 |
| JU2058 |
rrf-3(pk1426) II; mfIs70 IV; rde-1(ne219) V. |
mfIs70 [lin-31p::rde-1 + myo2p::GFP]. mfIs70 is a spontaneous integration in LG IV. Superficially wild-type. This strain can be used for Pn.p-specific RNAi. Reference: Barkoulas et al. (2013) Developmental Cell Jan 14;24(1):64-75 |
| NK2115 |
cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. |
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. |
| NK640 |
rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs102. |
qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi. |
| NK741 |
rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. |
qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion. |
| NK742 |
rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. |
qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion. |
| NR221 |
rde-1(ne219) V; kzIs8. |
kzIs8 [lin-26p::NLS::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
| NR222 |
rde-1(ne219) V; kzIs9. |
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi. |
| NR350 |
rde-1(ne219) V; kzIs20. |
kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]. Muscle specific RNAi. kzIs20 genotype differs from published data; this information is correct per Hiroshi Qadota. |
| QK52 |
rde-1(ne219) V; xkIs99. |
xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66. |
| RA382 |
rdIs7 I; unc-119(ed3) III; rde-1(ne219) V. |
rdIs7 [hnd-1::rde-1 + unc-119(+)] I. Rescued for RNAi in the mesoderm and SGPs. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83. |
| SD1954 |
rde-1(ne219) V; kzIs9; wgIs600. |
kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi. wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. |
| SD1963 |
unc-119(ed3) III; rde-1(ne300) V; gaEx234. |
gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS. |
| SD1965 |
unc-119(ed3) III; rde-1(ne300) V; gaEx233. |
gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS. |
| SD1989 |
rde-1(ne300) V; gaIs290. |
gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
| TU3135 |
mec-8(u218) I; rde-1(ne219) V; uIs46. |
uIs46 [rde-1p::mec-2(intron9)::rde-1) + ceh-22::GFP]. Temperature sensitive; maintain at 15 C. RNAi-sensitive at 15 C. Mechanosensory abnormal at 25 C. Uses the ninth intron of mec-2, whose splicing depends on mec-8, to produce temperature-sensitive expression and temperature-sensitive RNAi. Reference: Calixto et al. (2010) Nature Methods 7:407-11. |
| VP303 |
rde-1(ne219) V; kbIs7. |
kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92. |
| WM118 |
rde-1(ne300) V; neIs9 X. |
neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Transgene rescues muscle RNAi defect. Rollers. |
| WM27 |
rde-1(ne219) V. |
RNAi deficient. |
| WM28 |
unc-32(e189) III; rde-1(ne219) V. |
RNAi deficient. Unc. |
| WM45 |
rde-1(ne300) V. |
RNAi deficient. Reference: Tabara H, et al. Cell 1999 Oct 15:99(2):123-32. |
| XE1057 |
eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1375 |
wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1474 |
wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1581 |
wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |
| XE1582 |
wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. |
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921. |