Variation Information: n2595

Namen2595 View on WormBase
Species C. elegans
Genetic positionX:-2.56 +/- 0.000 cM
Genomic positionX: 6706982..6706982
Protein changeK11G12.2 Substitution

Strains carrying this variation

Strain Genotype Species Description
CZ9676 acr-2(n2595 n2420) X. C. elegans Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.