Caenorhabditis Genetics Center (CGC)

Laboratory Information

NameCH View on WormBase
Allele designationcg
HeadKramer, Jim
InstitutionNorthwestern University Medical School, Chicago, IL
Address Dept. of Cell & Molecular Biology, Ward 7-334 Northwestern University Medical School 303 E. Superior Street Chicago, IL 60611-3008

Website http://www.cmb.northwestern.edu/faculty/james_kramer.htm
Gene classes clb  cle  dgn  gpn  hsb  lge  nid  ppn  pxd  pxn  zmp 

Strains contributed by this laboratory

Strain Genotype Species Description
CH116 hsb-1(cg116) IV. C. elegans Viable and fertile. Deletion of 664 bp, molecular null.
CH1179 unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CH118 nid-1(cg118) V. C. elegans Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.
CH1180 unc-32(e189) emb-9(cg56)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.
CH119 nid-1(cg119) V. C. elegans Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.
CH120 cle-1(cg120) I. C. elegans Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
CH121 dgn-1(cg121)/dpy-6(e14) unc-115(mn481) X. C. elegans Heterozygotes are WT and segregate WT, DpyUncs, and Ste (and Gon) cg121 homozygotes.
CH123 dgn-2(ok209) X. C. elegans Animals appear wild type.
CH1315 zmp-1(cg115) III. C. elegans Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
CH1445 unc-119(ed3) III; cgEx198. C. elegans cgEx198 [(pJC14) bli-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Transgene rescues bli-1 phenoptype. GFP expression is detectable in late L4-adult.
CH1869 dgn-1(cg121) X; cgEx308. C. elegans cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.
CH1878 dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308. C. elegans cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
RW3539 emb-9(st545)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
cg116 Allele deletion
cg46 Allele deletion
cg118 Allele deletion
cg56 Allele substitution
cg119 Allele deletion
cg120 Allele deletion
cg121 Allele deletion
cg115 Allele deletion