| RG3080 |
cchl-1(ve580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1136 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve580 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttattaggcttatggagcggtgggtaaatt ; Right flanking sequence: cacggaaatgatgaaactagagaaaaaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3081 |
clx-1(ve581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. |
Homozygous viable. Deletion of 2495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgggaatgttgtggaactttgaatctatg ; Right flanking sequence: gtttttcgccattttgattcgggttcgact. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3082 |
cope-1(ve582[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. |
Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaagtccgcaatattacattgcgcgtgaag ; Right flanking sequence: CATGGGTTATCGATTTCAATGAGAAGGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3083 |
copz-1(ve583[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 898 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead eggs (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atcggctcgtaaatctacacgaaaacctag ; Right flanking sequence: CACAAATCGGCTTCTCGTTCATGAAATCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3084 |
melo-3(ve584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. |
C25D7.1. Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3085 |
mrpl-34(ve585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. |
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3086 |
+/hT1 [umnIs58] I; cmd-1(ve586[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. |
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve586 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gattttttctctctcgtcaccgtttcaccc ; Right flanking sequence: acctgtaaaaccccataaaaaaatttaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3087 |
dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. |
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3088 |
ddp-1(ve588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. |
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygotes have small broods that never mature. Deletion of 401 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 have small broods that never mature (ve588 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatctatagtttttctcacaggaaATGGA; Right flanking sequence: ttaggctcttttccataaattttcccttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3089 |
dgtr-1(ve589[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve589 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaactacggtcaaaatcgttgcgagaccct ; Right flanking sequence: GACACTCATCTCATCTTCCAGTGActtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3090 |
dhps-1(ve590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3091 |
+/nT1 [umnIs49] IV; dlst-1(ve591[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae (ve591 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattaaaaattttgtgaaagcatgaccaa ; Right flanking sequence: TCTGGAAAGAAACCGATGAACTGATACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3092 |
hoe-1(ve592[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest with occassional escapers. Deletion of 3396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae with occasional escapers (ve592 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaagtaacaatgaactaaaaacgtgaata ; Right flanking sequence: TTGATTGTCGCAGATTTGAGATGCTTGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3093 |
+/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3094 |
+/mT1[umnIs52] II; F10E9.5(ve594[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| KRA467 |
lin-39(kas9[lin-39::mNG::AID*]) III. |
mNeonGreen::3xFLAG::AID* was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| KRA437 |
unc-3(n3435) X; kasEx147. |
kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| KRA439 |
unc-3(n3435) X; kasEx149. |
kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| KRA441 |
unc-3(n3435) X; kasEx151. |
kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| KRA235 |
pha-1(e2123) III; kasEx80. |
kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| KRA334 |
kasEx73. |
kasEx73 [unc-3p::dsUnc-3(RNAi) + myo-2p::GFP]. Pick GFP+ to maintain array. Array carries a construct with the unc-3 promoter driving transcription of a hairpin targeting unc-3 for RNAi depletion in cholinergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| KRA102 |
lin-39(kas1) III; ynIs40 V; unc-3(n3435) X. |
ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065. |
| AH3437 |
tln-1(zh117[gfp::tln-1]) I. |
Wild-type morphology. Endogenous GFP reporter for tln-1. Reference: Walser M, et al. PLoS Genet. 2017 Jan 30;13(1):e1006592. |
| XE1158 |
juIs76 II; wpIs15 X. |
juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. wpIs15 [unc-47p::KillerRed] X. Slight Unc. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpIs15 produces a Shrinker phenotype after illumination by white light for 2 hrs. Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63. |
| MAH349 |
sqIs35. |
sqIs35 [sqst-1p::sqst-1::GFP + unc-122p::RFP]. Strain over-expresses GFP-tagged p62/SQST-1, a key autophagy substrate. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648. |
| MAH704 |
sqIs56. |
sqIs56 [rgef-1p::sqst-1::GFP + unc-122p::RFP]. Neuronal over-expression of GFP-tagged p62/SQST-1, a key autophagy substrate. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648. |
| MAH844 |
sqEx146. |
sqEx146 [sqst-1p::sqst-1 + rol-6]. Pick Rollers to maintain array. Strain over-expresses non-tagged p62/SQST-1, a key autophagy substrate. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648. |
| MAH914 |
sqst-1(syb764) IV. |
Full CRISPR deletion of sqst-1 locus. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648. |
| NC106 |
unc-37(e262 wd26) I. |
Incompletely-penetrant exploding vulva. wd26 (E580K) is an intragenic revertant of the e262 allele for the backward movement phenotype; it is not known if it also modifies other e262 phenotypes. The wd26 lesion (E580K) is molecularly identical to wd14, wd16, wd17, wd18, etc. Reference: Pflugrad A, et al. Development. 1997 May;124(9):1699-709. |
| PD2856 |
unc-54(cc2856[unc-54::gfp]) I. |
Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23. |
| OP808 |
unc-119 (tm4063) III; wgIs808. |
wgIs808 [ceh-58::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. |
| RW12222 |
rcor-1(st12222[rcor-1::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12226 |
pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12227 |
lin-29(st12227[lin-29::TY1::EGFP::3xFLAG]) II. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| OP810 |
unc-119 (tm4063) III; wgIs810. |
wgIs810 [C06A6.2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. |
| RW12210 |
hmg-1.2(st12210[hmg-1.2::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12215 |
mcd-1(st12215[mcd-1::TY1::EGFP::3xFLAG]) II. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12224 |
ref-1(st12224[ref-1::TY1::EGFP::3xFLAG]) II. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12225 |
sdc-1(st12225[sdc-1::TY1::EGFP::3xFLAG]) X. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12230 |
saeg-2(st12230[saeg-2::TY1::EGFP::3xFLAG]) III. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| OP809 |
unc-119 (tm4063) III; wgIs809. |
wgIs809 [ets-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. |
| RW12229 |
unc-54(st12229[unc-54::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| OP797 |
unc-119 (tm4063) III; wgIs797. |
wgIs797 [flt-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. |
| RW12231 |
attf-6(st12231[attf-6::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12232 |
F39B2.1(st12232[F39B2.1::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12234 |
hmg-3(st12234[hmg-3::TY1::EGFP::3xFLAG]) I |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12237 |
madf-6(st12237[madf-6::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12238 |
nfya-2(st12238[nfya-2::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| RW12240 |
hmg-20(st12240[hmg-20::TY1::EGFP::3xFLAG]) I. |
CRISPR/Cas9 engineered tagged endogenous locus. |
| OP782 |
unc-119 (tm4063) III; wgIs782. |
wgIs782 [ztf-14::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. |