| TY824 |
C. elegans |
+/szT1 [lon-2(e678)] I; sdc-2(y74)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Lon males, and dead eggs. sdc-2(y74)/sdc-2(y74) is lethal, although about 3% of the animals escape the lethality. These animals are extremely Dpy, extensively masculinized, and never fertile.
|
|
| RB2325 |
C. elegans |
Y74C9A.5(ok3157) I. Show Description
Y74C9A.5 Homozygous. Outer Left Sequence: cgaatccttaaatcctggca. Outer Right Sequence: aattctgccaactccaatgc. Inner Left Sequence: gtggatagcaagctgccagt. Inner Right Sequence: gccgtcggaataatgtcaat. Inner Primer PCR Length: 1202. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB880 |
C. elegans |
Y74C9A.4(ok727). Show Description
Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| TOG3 |
C. elegans |
Y74C10AL.2(ogr3) I. Show Description
Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa
|
|
| VC3124 |
C. elegans |
Y74C9A.3(gk3247) I; C03C10.2(gk3027) III; gkDf34 V. Show Description
This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|