| GE2245 |
C. elegans |
unc-32(e189) tim-1(t1545)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. tim-1 is temperature sensitive: progeny are viable at 15C, and dead at 25C. Previously called csg-5(t1545). Received new stock 5/04.
|
|
| GE3841 |
C. elegans |
unc-32(e189) tim-1(t1545) III. Show Description
Unc. Temperature sensitive tim-1. Viable at 15C. Mel at 25C.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| MT15454 |
C. elegans |
mir-243(n4759) IV. Show Description
Deletion breakpoints are:CAGAGATCGTGTGACAAT / GACGTTGACGCGAAGAAG.... GAGTAGTGTAATTTCCAATTTTTAT / AGATTAATTCAGGGGTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|