Search Strains

More Fields
Strain Species Genotype Add
HBR2317 C. elegans nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PHX1446 C. elegans nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. Show Description
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791