Search Strains

F42A8.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- gk165 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About four mitoflash events per anterior pharynx per 200 seconds on adult days 2-3 when cultured on standard NGM plates at 20C. In hqIs180 mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About six mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

mNeonGreen tag inserted into C-terminus of endogenous sdhb-1 locus. Animals are slow growing with reduced brood size. Insertion verified by PCR. Left flanking sequence: 5' AACTGATGATGTAGCCGCCAAG 3' ; Right flanking sequence: 5' CAGTGAAAGTGCGTGTAGGA 3'. sgRNA: 5' ATCTCTCCGATGGCCTTAGC 3'.

Homozygous viable. sdhb-1(tr405) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr406) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr411) is a T779A (I260N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr414) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr438) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr454) is a C434T (P145L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.

Homozygous viable. sdhb-1(tr455) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.