Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JK3826 C. elegans mut-16(mg461) I; larp-1(q783) III. Show Description
Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC.
JK4545 C. elegans larp-1(q783) III. Show Description
Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC.