Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1110 C. elegans +/szT1 [lon-2(e678)] I; ptr-4(ok1576)/szT1 X. Show Description
C45B2.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1576 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
UP3755 C elegans ptr-4(cs264[ptr-4::sfGFP]) X. Show Description
sfGFP tag inserted at C-terminus of endogenous ptr-4 locus using CRISPR/Cas9 SEC/SapTrap method. gRNA: tttctagagtcggggtgaaa Reference: Cohen JD, et al. Genetics. 2021 Nov 5;219(3):iyab132. doi: 10.1093/genetics/iyab132. PMID: 34740248.