Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OH3682 C. elegans otIs114 I; lsy-12(ot154) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER.
OH19333 C. elegans aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19337 C. elegans tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.