Search Strains

More Fields
Strain Species Genotype Add
OH17241 C elegans unc-86(ot1158) III. Show Description
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.