Search Strains

More Fields
Strain Species Genotype Add
NL4517 C. elegans alg-2(ok304) II; pkIs2256. Show Description
pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.
RB574 C. elegans alg-2(ok304) II. Show Description
T07D3.7. Homozygous. Outer Left Sequence: tctgagtttggctcgatgtg. Outer Right Sequence: atgttccttggataccagcg. Inner Left Sequence: agcccagaactgggaaactt. Inner Right Sequence: aagtcgaattccgttggatg. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WM53 C. elegans alg-2(ok304) II. Show Description
T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.
RB2246 C. elegans T11F1.9(ok3040) II. Show Description
T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2247 C. elegans eat-17(ok3041) X. Show Description
T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2248 C. elegans gst-24(ok3042) II. Show Description
F37B1.1. Homozygous. Outer Left Sequence: GCGACGATTCATGGTCTTTT. Outer Right Sequence: CTCTCCCTCCCCTCAATTTC. Inner Left Sequence: CAAACTCCCCAGGTGTGACT. Inner Right Sequence: GGAGATTTTCGAAACGACTTTG. Inner Primer PCR Length: 1157 bp. Deletion Size: 555 bp. Deletion left flank: TCATTAACCTTCTCACGGAGCGCTGCAAGC. Deletion right flank: AGTTATACAAATACCACTAAAAATGTTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2249 C. elegans F32H2.6(ok3043) I. Show Description
F32H2.6. Homozygous. Outer Left Sequence: GGAAGACGAGCTTCCAGATG. Outer Right Sequence: TCTCGACGGTTTCCGTTATC. Inner Left Sequence: GAGGAAGAAGCTCAGGGTCC. Inner Right Sequence: CATCTGTGCCGTGCAGTAAT. Inner Primer PCR Length: 1288 bp. Deletion Size: 380 bp. Deletion left flank: ATGCCACCGAACATTTTGACTTCTTTATTA. Deletion right flank: GACGACTATCCTTTGTGGCAAAAGAAGAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2250 C. elegans puf-6(ok3044) II. Show Description
F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2251 C. elegans cpg-8(ok3045) V. Show Description
K03B4.7. Homozygous. Outer Left Sequence: TCGAGGATCTCAAGGATTGG. Outer Right Sequence: CCAAATAGACCCGCAACATT. Inner Left Sequence: CTCGACTCGTTGACGACCTT. Inner Right Sequence: TTTGATCTACTCTTTTAGCCAGTTT. Inner Primer PCR Length: 1258 bp. Deletion Size: 979 bp. Deletion left flank: TGCTTTGAGCAAAAAAAATTGAAAGAACGT. Deletion right flank: GTGCGGGGAGAGTGACCAGAAACTGATGAG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2252 C. elegans nas-3(ok3046) V. Show Description
K06A4.1. Homozygous. Outer Left Sequence: CTTAAAGGTCGAAGCATGGC. Outer Right Sequence: TGTTGAAGCACAAAGATCGG. Inner Left Sequence: TTCACCCACTCCAACTTCTAA. Inner Right Sequence: CGGCGCTTTCTGAAATAAAA. Inner Primer PCR Length: 1162 bp. Deletion Size: 377 bp. Deletion left flank: CTCCGAACCACCAAAGGATGACGATATCGC. Deletion right flank: TGGCTCTTCGGAACTCGTGATGGAAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2321 C. elegans gcy-18(ok3047) IV/nT1 [qIs51] (IV;V). Show Description
ZK896.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3047 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCGCTAATCCACTGGAACG. External right primer: CGATCCTCCAACCAGAATGT. Internal left primer: CTGCAAAAGATTCGGACGAT. Internal right primer: GTGCCCTTTCCTTTCACTTG. Internal WT amplicon: 1263 bp. Deletion size: 517 bp. Deletion left flank: TTTCAGCAATAATCTATATGGCTCCTGAAC. Deletion right flank: GAATGTTAGAAGAAGCCAACATCCGTGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2352 C. elegans R07C12.1(ok3048) IV/nT1 [qIs51] (IV;V). Show Description
R07C12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3048 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATTTGGAGGCCAGTGTTGT. External right primer: GCCCTGAAACCGAAGTGTAA. Internal left primer: GCTCTGTTTGTAGGCTTGGG. Internal right primer: CAGCATATGGTGGCCAGTAG. Internal WT amplicon: 1301 bp. Deletion size: 537 bp. Deletion left flank: AATTGGTAGTGACTCGTTGAAAATTGTTGA. Deletion right flank: TGGTATACGTTTCTTTAAATTTTTTTTAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807