Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB511 C. elegans T05A7.11&fut-5(ok242) II. Show Description
T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DG4454 C. elegans npp-12(ok2424) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) Show Description
Homozygous ok2424 animal are viable and fertile, but will go sterile in successive generations. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2424 homozygotes (superficially wild-type with some sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived from parental strain RB1874, originally provided to the CGC by the OMRF Knockout Group, part of the International C. elegans Gene Knockout Consortium. Paper_evidence WBPaper00041807
RB1872 C. elegans C27A2.1(ok2421) II. Show Description
C27A2.1. Homozygous. Outer Left Sequence: ATGCAACGTGCTAAAGCAAA. Outer Right Sequence: GTGGTTCCATTCCACATTCC. Inner Left Sequence: AAGCTCGAGCGAGACTTCAG. Inner Right Sequence: ACATCTGAATGGAACTGGGC. Inner Primer PCR Length: 3285 bp. Deletion Size: 2424 bp. Deletion left flank: AAATAATATTTATTTTTGTTGAAAAATTAG. Deletion right flank: TTGAAAACCGTGCACGTATCCACGATAAAC. Insertion Sequence: CTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1875 C. elegans Y65B4A.3(ok2425) I. Show Description
Y65B4A.3. Homozygous. Outer Left Sequence: ACCTCCTCAGACGACTCGAA. Outer Right Sequence: GAGCGCGAAAATTCAAAGAG. Inner Left Sequence: GTCGCCATATCGTCGTTTTT. Inner Right Sequence: CCGATTTTAGAGGAAGACCAGA. Inner Primer PCR Length: 3213 bp. Deletion Size: 1830 bp. Deletion left flank: CATGGTTTCCGACTGTTTTTCCTGTTAAAT. Deletion right flank: TTTTTTCCACATGTGTGGATCTCAATTTAT. Insertion Sequence: GTTAAAAAATGTATGAAAAAAAATTTTAAAAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1877 C. elegans Y44A6D.3(ok2427) V. Show Description
Y44A6D.3. Homozygous. Outer Left Sequence: AGGTGTTCCACCAGCACAAT. Outer Right Sequence: TGCCGTGCTTCTATCTTCCT. Inner Left Sequence: TCTCTCATCTTTCGCTTCACC. Inner Right Sequence: CAACTCTTAAGCCACAAAACTGT. Inner Primer PCR Length: 3141 bp. Deletion Size: 1471 bp. Deletion left flank: ATTCTGATGGAAATGACTAGAAGGCAAGGC. Deletion right flank: ATTGATGTGCCTGAAATTTGAAAAAAATGT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1878 C. elegans ptp-3(ok2428) II. Show Description
C09D8.1 Homozygous. NOTE: C09D8.1 used to be ptp-1; ptp-1 is now C48D5.2. Outer Left Sequence: aaatccgttgagcaaacacc. Outer Right Sequence: gtccttctcgattttcagcg. Inner Left Sequence: ttttacggccaattttctgc. Inner Right Sequence: atatccttgtgcgcgtaacc. Inner Primer PCR Length: 2770. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1832 C. elegans ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1833 C. elegans sem-2(ok2422) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1931 C. elegans K03D10.3(ok2429)/hIn1 [unc-101(sy241)] I. Show Description
K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3196 C. elegans smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
YE57 C. elegans smc-5(ok2421)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.