Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MX124 C. elegans ifta-1(nx61) X. Show Description
Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.