| VC361 |
C. elegans |
mir-42(gk177) II. Show Description
ZK930.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| DPB2312 |
C. elegans |
mir-43(sjm2) II. Show Description
Homozygotes lack obvious gross phenotypes. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain is also homozygous for a G>T point substitution at position 8 of miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DPB2313 |
C. elegans |
mir-43(sjm3) II. Show Description
Homozygotes lack gross phenotypes. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between miR-42* and miR-42. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DPB2315 |
C. elegans |
mir-43(sjm2) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm2) has positions 9-23 of miR-43 substituted for random sequence. This strain also has a G>T point substitution at position 8 of miR-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm2) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| DPB2316 |
C. elegans |
mir-43(sjm3) II; ebax-1(tm2321) IV. Show Description
Homozygotes lack obvious gross phenotypes, though some miRNAs are elevated due to loss-of-function mutation in ebax-1. mir-43(sjm3) has positions 9-23 of miR-43 substituted for the 3' region of miR-82. This strain is also homozygous for a G>T point substitution at position 8 of miR-42, and furthermore has 22bp of sequence deleted between mir-42* and mir-42. Generated by mating parental strain CZ9907 hermaphrodites to mir-43(sjm3) males. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.
|
|
| MT13372 |
C. elegans |
nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT14117 |
C. elegans |
mir-2(n4108) I; nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| VL188 |
C. elegans |
unc-119(ed3) III; wwEx26. Show Description
wwEx26 [mir-42-44p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|