Search Strains

More Fields
Strain Species Genotype Add
VC2138 C. elegans kcnl-2(ok2818) I. Show Description
F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
PS9380 C. elegans kcnl-2(sy1754) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9381 C. elegans kcnl-2(sy1755) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: GAATGGAGCAATTGGAGATGATTCAACAGTTCCAT right flanking sequence: TGATGGACGAAAAAGATGATAACAGgttagttattc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATTCAACAGTTCCATTGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616