More Fields
Strain Species Genotype
PS9380 C. elegans kcnl-2(sy1754) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616