Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1388 C. elegans ZK1251.1&ins-7(ok1573) IV. Show Description
ZK1251.1, ZK1251.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CF2266 C. elegans muEx340. Show Description
muEx340 [ges-1p::RFP + ges-1p::ins-7]. Intestinal expression of ins-7 shortens lifespan. Pick RFP animals to maintain.
OH18835 C. elegans ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
PHX5424 C. elegans ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
SSR1617 C. elegans ssrIs1240; ssrIs615. Show Description
ssrIs1240 [ges-1p(deltaB)::ins-7::mCherry]. ssrIs615 [unc-122p::GFP]. The INS-7::mCherry fusion protein localizes in GFP-labeled coelomocytes. ges-1p(deltaB) is an INT1-specific promoter. Reference: Liu CC, et al. Nat Commun. 2024 Aug 11;15(1):6869. doi: 10.1038/s41467-024-51077-3. PMID: 39127676.
SSR1621 C. elegans ins-7(ssr1532) IV. Show Description
Null allele. ins-7(ssr1532) is a CRISPR-engineered deletion that removes the second exon of ins-7 and introduces stop codons. Reference: Liu CC, et al. Nat Commun. 2024 Aug 11;15(1):6869. doi: 10.1038/s41467-024-51077-3. PMID: 39127676.
HT1702 C. elegans unc-119(ed3) III; wwEx66. Show Description
wwEx66 [ins-7p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.