Search Strains

More Fields
Strain Species Genotype Add
VC2879 C. elegans glb-3(ok3630) V/nT1 [qIs51] (IV;V). Show Description
C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CHS1713 C. elegans glb-33(yum2917) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
VC4085 C. elegans glb-31(gk5173) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.