Search Strains

More Fields
Strain Species Genotype Add
VC729 C. elegans gna-2(gk308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23G11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk308 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3192 C. elegans Y50D7A.4(gk3089)/sC1 [dpy-1(s2170)] III. Show Description
Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3209 C. elegans Y48G10A.4(gk3088)/hIn1 [unc-101(sy241)] I. Show Description
Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3222 C. elegans C30B5.4(gk3082)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C30B5.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3082 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGGTGTGTGCATAAGGA. External right primer: TTGATTGAATTGGCGATGAA. Internal left primer: GAGAGCTTCGGAAGACATGG. Internal right primer: TCCAGGTTCCCTGAAACAAG. Internal WT amplicon: 1567 bp. Deletion size: 390 bp. Deletion left flank: AAAATTTGAAAAAGGCTTTATATTAATGTT. Deletion right flank: TCGGATTCATGTTTTACTGCAAAATGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3223 C. elegans +/mT1 II; atf-7(gk3083)/mT1 [dpy-10(e128)] III. Show Description
C07G2.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3083 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 836 bp. Deletion left flank: CCGTTTTGTGGACGTCCAACTGGATTTCCA. Deletion right flank: TTGGCTTCCAAAGCTTCAAGAGATTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3267 C. elegans ned-8(gk3086) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome (gk3086 in F45H11.2) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3086 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 1145 bp. Deletion left flank: ATTCTCAGGATTTTTTGTTACCATAGTGTT. Deletion right flank: TCTTACAAATACTGCGCGTTCTGATCTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807