Search Strains

More Fields
Strain Species Genotype Add
BN147 C. elegans emr-1(gk119) I; bqSi142 II. Show Description
bqSi142 [emr-1p::emr-1::mCherry + unc-119(+)] II. Might contain unc-119(ed3) in the background. Single-copy emr-1::mCherry transgene under control of emr-1 regulatory sequences. emr-1(gk119) embryos arrest when lem-2 is depleted by RNAi; bqSi142 fully rescues this phenotype. Reference: Morales-Martínez A, Dobrzynska A, Askjaer P. J Cell Sci. 2015 Feb 4.
VC237 C. elegans emr-1(gk119) I. Show Description
M01D7.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10123 C. elegans R11G1.6(gk1190) X. Show Description
R11G1.6. External left primer: GAGACGTTGAAGTACGCGCT. External right primer: CCGAAAATTCGAAAGCGTAA. Internal left primer: TTACCCAGAGACCGAACTGC. Internal right primer: CTTCATCGCCCTCTTTCCTT. Internal WT amplicon: 838 bp. Deletion size: approximately 200 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: AAAGGATCACCCACAGCATCTCTCCAAACAGCCAACCCAAAACTAAAATT. Left deleted probe: AAAACAATGAGTACGGATTCAAAAATAAAACCTTGTAGGAAACTTGTGTA. Right deleted probe: GGATTCGATGGCATCTGTATAGAGTTGAATGGCATAATTATAGGCATTTA. Right flanking probe: GAAGCGATTCGAATCGTTCTCCCGACAACATCTTAGGAACAACGGCCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10124 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10127 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10131 C. elegans fbxc-44(gk1193) II. Show Description
C16A11.6. External left primer: TCCACGGGAATTTCTACTGC. External right primer: CGCAAATTTTTCCGTGTTTT. Internal left primer: CTCCTTCAATCCAGCTTTCG. Internal right primer: AGACAATTCCGCCAACAATC. Internal WT amplicon: 3801 bp. Approximate deletion size: 1600 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: CGATAAATCGTTCGATTAGGGGGTTATCCGATGACCGAGTCATGAAATGT. Left deleted probe: CATAAACCGCCAAGGTTCGTGAATCCTGTGCGACGCCAACTTAAATTAGT. Right deleted probe: TGAAATTTCGAACCTTGAACTTCTTAAATGACTGGGGCAGCTCAAGAATA. Right flanking probe: AAAATGCGTGCGGCGCGTTGCAACTTAGCTCCGCCCACCCTTTGAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10165 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10166 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC1970 C. elegans gkDf42 gkDf43 I; Y47D3B(gk1197) III. Show Description
This strain is homozygous for a deletion (gk1197) in Y47D3B, detectable by PCR using the following primers. External left primer: AAACGCGAAAATGTCGAAAC. External right primer: GATGTCTTCTCCCCCTCCTC. Internal left primer: GCGTCAAATATGTCGCGTAA. Internal right primer: TTAGTAGGCGGCTTTGTGGT. Internal WT amplicon: 1949 bp. Deletion size: 233 bp. Deletion left flank: ACCCCTGGACGTTTGGGCGCGTTTTTGTCA. Deletion right flank: TTTTCAGATAGTACACACACACATAGGAAA. Validation: No CGH probes for gk1197. Other deletions (gkDf42, gkDf43) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2377 C. elegans C14A4.13(gk1199) II. Show Description
C14A4.13. Identified by PCR, validated by CGH. External left primer: CACCTTTCCCCATGAAAATG. External right primer: GTCGCCAATGAGACGAATTT. Internal left primer: GCAGCAGTAGTGGCAGTGAA. Internal right primer: TTTCCCGAAGAAGAACGATG. Internal WT amplicon: 2574 bp. Deletion size: 1569 bp. Deletion left flank: CGATTCGCTTGCAAAGCTGAGCTCGCAATT. Deletion right flank: TACCAAAGTCCCACCTGCTCATTAGATTGA. Insertion Sequence: TCGGTTTAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807