More Fields
Strain Species Genotype
VC10131 C. elegans fbxc-44(gk1193) II. Show Description
C16A11.6. External left primer: TCCACGGGAATTTCTACTGC. External right primer: CGCAAATTTTTCCGTGTTTT. Internal left primer: CTCCTTCAATCCAGCTTTCG. Internal right primer: AGACAATTCCGCCAACAATC. Internal WT amplicon: 3801 bp. Approximate deletion size: 1600 bp. This deletion was identified by comparative genome hybridization (CGH) and confirmed by PCR, but was not sequenced. Left flanking probe: CGATAAATCGTTCGATTAGGGGGTTATCCGATGACCGAGTCATGAAATGT. Left deleted probe: CATAAACCGCCAAGGTTCGTGAATCCTGTGCGACGCCAACTTAAATTAGT. Right deleted probe: TGAAATTTCGAACCTTGAACTTCTTAAATGACTGGGGCAGCTCAAGAATA. Right flanking probe: AAAATGCGTGCGGCGCGTTGCAACTTAGCTCCGCCCACCCTTTGAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807