| NM2686 |
C. elegans |
elks-1(js805) IV. Show Description
Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.
|
|
| NM2775 |
C. elegans |
elks-1(js816) IV. Show Description
Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.
|
|
| VC2392 |
C. elegans |
elks-1(ok2762) IV. Show Description
F42A6.9. External left primer: TCTCAGCTCATCGGTACCCT. External right primer: CCTTATGGTTAGGGCCACCT. Internal left primer: CATAACTCGGCTCCCTGCTA. Internal right primer: GGCCTAGGAATCTCTTACACAGTC. Internal WT amplicon: 1124 bp. Deletion size: 702 bp. Deletion left flank: GTTCTCAATGGTCGCCTTCAACTGTGTCAT. Deletion right flank: GTTTTCGATAGCTTGCCGGCCTGATGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| TV24780 |
C. elegans |
elks-1(wy1249[GFP::elks-1]) IV. Show Description
GFP tag inserted into N-terminus of endogenous elks-1 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV24785 |
C. elegans |
wyIs891 III; elks-1(wy1232[FLPon::mScarlet-I::elks-1]) IV; syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous elks-1 locus. GFP tag inserted into endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV25687 |
C. elegans |
elks-1(wy1391) IV. Show Description
GFP tag inserted into endogenous elks-1 locus with ELKS-1(301-3350), ELKS-1(716-775), and ELKS-1(807-836) regions deleted. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV25712 |
C. elegans |
elks-1(wy1397) IV. Show Description
elks-1(wy1397) is a CRISPR-engineered deletion of ELKS-1(301-3350), ELKS-1(716-775), and ELKS-1(807-836). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| UJ2587 |
C. elegans |
elks-1(miz365[elks-1::7xGFP11]) IV. Show Description
7xGFP11 tag inserted into endogenous elks-1 locus. ELKS-1::7xGFP localizes to tip of synapses similar to CLA-1. miz365 genotyping primers: F: TACCGGCTCCAGTGATTCC / R: tgtgtgccattggatgtgag (wt = 203bp, mutant = 676bp). Reference: Kurashima M, et al. Genetics. 2025 Mar 17;229(3):iyae214. doi: 10.1093/genetics/iyae214. PMID: 39708832.
|
|
