Search Strains

meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped.

Small, severely uncoordinated. Spontaneous segregant from N2/RW7000 (Bristol/Bergerac) hybrid strain. Daf-d.

oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.

weIs11[unc-119(+) + TAC-1::GFP].

weIs12[unc-119(+) + pie-1p::GFP::csnk-1].

weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.

zuEx24 [hmp-1::GFP + unc-119(+)]. Animals with the duplication are WT. Occasionally pick green hermaphrodites to maintain. zuEx24 transmits at a very high frequency.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Superficially wild-type.

mhIs9 [lin-17::GFP]. Full length lin-17, expressed T.p cells. Rescues lin-17 mutants. unc-119(e2498) may no longer be in the background.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC.