Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
ZT29 C. elegans cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT31 C. elegans cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT33 C. elegans cec-8(fj63) III. Show Description
No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT34 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT35 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.