Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DG4190 C. elegans cdc-25.3(tn1712[gfp::3xflag::cdc-25.3]) III. Show Description
Superficially wild type
RB647 C. elegans cdc-25.3(ok358) III. Show Description
ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
BC12401 C. elegans dpy-5(e907) I; sIs10527. Show Description
sIs10527 [rCes ZK637.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).