| CB6991 |
C. elegans |
mrp-1(pk89) bus-5(br19) X. Show Description
Skiddy hermaphrodites, bleach-sensitive, drug-hypersensitive, abnormal bacterial pathogen resistance. Reference: Stroud et al (in preparation).
|
|
| CB6992 |
C. elegans |
bus-5(br19) pgp-3(pk18) X. Show Description
Hypersensitive to drugs. Resistant to infection by M. nematophilum and Leucobacter Verde2. Hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation).
|
|
| DC19 |
C. elegans |
bus-5(br19) X. Show Description
Severe missense mutation. Bus (resistant to M. nematophilum), Bah (resistant to Yersinia biofilm formation), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1, drug and bleach sensitive. Slightly skiddy movement. Useful for drug screening. Reference: Xiong H, et al. Sci Rep. 2017 Aug 29;7(1):9839.
|
|
| HBR1900 |
C. elegans |
goeIs408. Show Description
goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1901 |
C. elegans |
goeIs407. Show Description
goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1902 |
C. elegans |
goeIs409. Show Description
goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1907 |
C. elegans |
goeIs410. Show Description
goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR191 |
C. elegans |
goeIs5. Show Description
goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
|
|
| HBR1911 |
C. elegans |
goeIs411. Show Description
goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1912 |
C. elegans |
goeIs412. Show Description
goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1914 |
C elegans |
goeIs413. Show Description
goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1961 |
C. elegans |
goeIs431. Show Description
goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HBR1971 |
C. elegans |
nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.
Primers for crossing:
Fwd: cgagacttttaaccccgtcg
InFwd: aaagcccatgacttgctgaa
Rev: gctcaggtggttagagggtt
Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
|
|