Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DH235 C. elegans zyg-8(b235) III. Show Description
Temperature sensitive. Egg lethal. Abnormal first cleavage. Maternal effect (m,n).
HBR1971 C. elegans nlp-42(syb235) V. Show Description
Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
RB2350 C. elegans clec-43(ok3188) II. Show Description
R07C3.1. Homozygous. Outer Left Sequence: ATGCAAGTTATGTGTGCGGA. Outer Right Sequence: GTTATTTGGAGAGGCTGCCA. Inner Left Sequence: TTTTGTGGGCCTGAGTTTTT. Inner Right Sequence: GCCGCATTATACATTCGGATA. Inner Primer PCR Length: 1270 bp. Deletion Size: 706 bp. Deletion left flank: TCCTCAGATGGAGATTATTCCTACTACAGC. Deletion right flank: ATAAGATCTATAACTCTACTACAAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2352 C. elegans C29F3.5(ok3190) V. Show Description
C29F3.5 Homozygous. Outer Left Sequence: cgttcaactcaccagatcca. Outer Right Sequence: ttcgcgccaagtctaatttt. Inner Left Sequence: ctgcccagtcaaaatcacatt. Inner Right Sequence: aggagtgatggaccaattttt. Inner Primer PCR Length: 1298. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2353 C. elegans Y110A7A.20(ok3191) I. Show Description
Y110A7A.20 Homozygous. Outer Left Sequence: gaatcaacaaatgcagtgcg. Outer Right Sequence: tgaaaacagaaccatcgtcg. Inner Left Sequence: tccaaccaaaaattgcttca. Inner Right Sequence: aaatgctcaaaagaatcccg. Inner Primer PCR Length: 1223. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2354 C. elegans F15D4.4(ok3200) II. Show Description
F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2355 C. elegans lev-1(ok3201) IV. Show Description
F09E8.7 Homozygous. Outer Left Sequence: atcgattgctcgttgagctt. Outer Right Sequence: gctcgactttctcacttcgg. Inner Left Sequence: gctcatcatccagctcatca. Inner Right Sequence: ccgtgtcgatttttcggaat. Inner Primer PCR Length: 1300. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2356 C. elegans C24B9.9(ok3202) V. Show Description
C24B9.9 Homozygous. Outer Left Sequence: ttatttctgggctcgcattc. Outer Right Sequence: agtagttgcggctgagttcc. Inner Left Sequence: ggtcgaagtgatacctgtgga. Inner Right Sequence: tgacattttgaagcaaatcaatg. Inner Primer PCR Length: 1238. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2357 C. elegans F41H10.6(ok3203) IV. Show Description
F41H10.6 Homozygous. Outer Left Sequence: ggggtgatttcgggtctaat. Outer Right Sequence: tccaacactcatcggattca. Inner Left Sequence: agtgaagtccgagacggaaa. Inner Right Sequence: agtatgcccaacacatccg. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2358 C. elegans Y54G2A.25(ok3204) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2359 C. elegans Y54G2A.25(ok3205) IV. Show Description
Y54G2A.25 Homozygous. Outer Left Sequence: gcatcgcaaacgagacataa. Outer Right Sequence: cttaggcattaggcaggcag. Inner Left Sequence: atgcgcactgtagttggtga. Inner Right Sequence: acaagtcaagcgtgtaggca. Inner Primer PCR Length: 1151. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807