Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
EGD334 C. elegans egxSi100 II; plk-1(egx3[C52V, L115G]); unc-119(ed3) III. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.
OD3696 C. elegans plk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III. Show Description
Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.