| RB772 |
C. elegans |
atf-6(ok551) X. Show Description
F45E6.2. Homozygous. Outer Left Sequence: GGCGGGAGTTTAGGAGATTC. Outer Right Sequence: AAAGGCACGGAAATTGAGAA. Inner Left Sequence: AATGACCAGGAAATGTGGGA. Inner Right Sequence: AAGTGTCAATTGGCCAGTCC. Inner primer WT PCR product: 2983. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB775 |
C. elegans |
T28D9.3(ok555) II. Show Description
T28D9.3. Homozygous. Outer Left Sequence: CCACTCTGCTTGGTGTCTCA. Outer Right Sequence: GGTGATCTGGATCTGGAGGA. Inner Left Sequence: GTGCTCAATGCAGCAACAGT. Inner Right Sequence: CGTCTTCAGCATCACGAGAA. Inner primer WT PCR product: 2632. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB782 |
C. elegans |
F27E5.1(ok564) II. Show Description
F27E5.1. Homozygous. Outer Left Sequence: CTGCCAGAGGTAAGTAGCCG. Outer Right Sequence: CAGATGGGAAGATCGGAAAA. Inner Left Sequence: TGAAAGACAACTTGCTCGGA. Inner Right Sequence: TGTCTTTTCAGCAGTCACCG. Inner primer WT PCR product: 3142. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB783 |
C. elegans |
scd-2(ok565) V. Show Description
T10H9.2. Homozygous. Outer Left Sequence: TGGTGGTGGTTCAAACTCAA. Outer Right Sequence: CGATGGCTAGAACACCCATT. Inner Left Sequence: ATCACAAACCAATTGGGGAA. Inner Right Sequence: GAGTCTGGCCGGTGTAGTGT. Inner primer WT PCR product: 3154. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB784 |
C. elegans |
F28H6.3(ok566) X. Show Description
F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB788 |
C. elegans |
F11D5.3(ok574) X. Show Description
F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB790 |
C. elegans |
atf-4(ok576) X. Show Description
T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB792 |
C. elegans |
F09C12.2(ok582) II. Show Description
F09C12.2. Homozygous. Outer Left Sequence: ATGACCGTGGAGTGTGACAA. Outer Right Sequence: CGATCCCTCACTCGGATAAA. Inner Left Sequence: GGTTGCAGGGGTTCTGAATA. Inner Right Sequence: CTTGGCTCATTTTTGACGGT. Inner primer WT PCR product: 3078. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB794 |
C. elegans |
nhr-41(ok584) IV. Show Description
Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB795 |
C. elegans |
F28H6.3(ok585) X. Show Description
F28H6.3. Homozygous. Outer Left Sequence: GGGTCCCCAGAGGTATTCAT. Outer Right Sequence: GAAAATGTTTCGGCTTCCAA. Inner Left Sequence: AGCACGAGAAGCTTTTTCCA. Inner Right Sequence: ACGAATTTTGCGAGACAACC. Inner Primer WT PCR Product: 2904. Deletion size: 531 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB799 |
C. elegans |
C25G6.5(ok594) X. Show Description
C25G6.5. Homozygous. Outer Left Sequence: CAGGGTCTTAACACGGCAAT. Outer Right Sequence: TGCCTTCAATTTCATCTCCC. Inner Left Sequence: CAAAAATTGGAAGGTGAGCC. Inner Right Sequence: AAATGGGATCGGTGAATGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB802 |
C. elegans |
srp-9(ok598) V. Show Description
F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB806 |
C. elegans |
tre-5(ok612) II. Show Description
C23H3.7. Homozygous. Outer Left Sequence: AAATGGCGATTCAAAGTTCG. Outer Right Sequence: TCTTTGCCACGTGACTGTTC. Inner Left Sequence: AACATCCGGGAAATCATCAA. Inner Right Sequence: CCCGTGGAATTTAAGACGAA. Inner primer WT PCR product: 2691. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB809 |
C. elegans |
ptl-1(ok621) III. Show Description
F42G9.9a. Homozygous. Outer Left Sequence: CCTCCTACCACCCATCTGAA. Outer Right Sequence: CAACATGCTCAGGGAAGTCA. Inner Left Sequence: TGAACCGAAGCCTAAACCAG. Inner Right Sequence: CTGGAAATTTGTTGGGCAGT. Inner primer WT PCR product: 2452. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB812 |
C. elegans |
fax-1(ok624) X. Show Description
F56E3.4. Homozygous. Outer Left Sequence: TAGTGCACGGACTAGGGCTT. Outer Right Sequence: AGATTGAGCACCACCAAACC. Inner Left Sequence: GGAAGCCCTAGCGAGAAGAT. Inner Right Sequence: CTTGAAGTGGCACGAGTCAA. Inner primer WT PCR product: 2430. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB813 |
C. elegans |
C41C4.1(ok625) II. Show Description
C41C4.1. Homozygous. Outer Left Sequence: CACCAGAAATTGAGCAAGCA. Outer Right Sequence: CCCTCGTCCATTTGCTACAT. Inner Left Sequence: TTGCATTTCGATTGGCATAA. Inner Right Sequence: CCCTGGTGATAACACGGTTT. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB814 |
C. elegans |
cdk-5(ok626) III. Show Description
T27E9.3, T27E9.4. Homozygous. Outer Left Sequence: GAAACTCAACTTCTTCGCCG. Outer Right Sequence: TCCGGTATACGCAAATGACA. Inner Left Sequence: ATGTCCGCTATGTTCAAGGG. Inner Right Sequence: TCATGTTGGCTTCCATCAAA. Inner primer WT PCR product: 2658. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB815 |
C. elegans |
F18F11.3(ok628) IV. Show Description
F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB817 |
C. elegans |
abt-4(ok633) V. Show Description
Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB822 |
C. elegans |
dhs-6(ok637) II. Show Description
C17G10.8. Homozygous. Outer Left Sequence: CCATAGAGCGTTCACAGCAA. Outer Right Sequence: CTAACGTGTGGCTTTGGGAT. Inner Left Sequence: TATGTGCACCTTTACGGGGT. Inner Right Sequence: ACGCAATGCTGATGAAGTTG. Inner Primer WT PCR product: 3096. Deletion size: 924 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB824 |
C. elegans |
F52F12.6(ok646) I. Show Description
F52F12.6. Homozygous. Outer Left Sequence: ACGGATGGAACAGGTGACTC. Outer Right Sequence: TCATGATGGATTGGCTGAAA. Inner Left Sequence: TTGGGAAATTTGGAAACTGG. Inner Right Sequence: TATGAAACAAATGCTGGCGA. Inner primer WT PCR product: 3150. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB829 |
C. elegans |
B0336.6(ok640) III. Show Description
B0336.6. Homozygous. Outer Left Sequence: GATACAATTCCCACGCCTTG. Outer Right Sequence: GGAAGGCGGAATGAGTGTTA. Inner Left Sequence: GCAGTGAGAGAACGAGCACA. Inner Right Sequence: CGAGTCATGCGAATCTTCAA. Inner primer WT PCR product: 2654. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB831 |
C. elegans |
tbx-8(ok656) III. Show Description
T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB835 |
C. elegans |
rcq-5(ok660) III. Show Description
E03A3.2. Homozygous. Outer Left Sequence: CACACGTTTTCGCATTTCAC. Outer Right Sequence: GGAGCGTACTTGCCACATTT. Inner Left Sequence: GCCAACTCTCCAGAAACCAA. Inner Right Sequence: TTTCAGAGATGAGCTCGGGT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB840 |
C. elegans |
nhr-40(ok667) X. Show Description
T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB845 |
C. elegans |
gur-4(ok672) II. Show Description
K09E4.5. Homozygous. Outer Left Sequence: TCGCGCAGTTATTTGAGTTG. Outer Right Sequence: TTCAATAATTCGGCTTTCGG. Inner Left Sequence: CGCCGAAACTTCTGAAAGTC. Inner Right Sequence: GTGTCTGAAATGGAGGGGAA. Inner primer WT PCR product: 3218. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB846 |
C. elegans |
F01D5.9(ok673) II. Show Description
F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB851 |
C. elegans |
inx-20(ok681) I. Show Description
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2909. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB852 |
C. elegans |
ras-2(ok682) III. Show Description
F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB853 |
C. elegans |
T14G12.4(ok683) X. Show Description
T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB859 |
C. elegans |
Y57A10C.6(ok693) II. Show Description
Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB860 |
C. elegans |
nck-1(ok694) X. Show Description
ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB865 |
C. elegans |
C05D2.3(ok703) III. Show Description
C05D2.3. Homozygous. Outer Left Sequence: AGATATTGCGACCCACTTG. Outer Right Sequence: TGTCGTCTATGCCGTTCAA. Inner Left Sequence: CGGATGTGAAGCCTGGTTA. Inner Right Sequence: GCGCAATTTCACGATCAAT. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB866 |
C. elegans |
klp-10(ok704) IV. Show Description
C33H5.4. Homozygous. Outer Left Sequence: CACACACCGAGACTGACGA. Outer Right Sequence: TTGATTCTCAGCCAGGCTCT. Inner Left Sequence: TAAATTAGCGATGCCCGAA. Inner Right Sequence: TTCTTCTTGTGCCTGCATTG. Inner primer WT PCR product: 2678. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB868 |
C. elegans |
xnd-1(ok708). Show Description
C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB869 |
C. elegans |
xnd-1(ok709). Show Description
C05D2.5. Homozygous. Outer Left Sequence: GAACCCATTGTTGCCAATCT. Outer Right Sequence: GAGGATCGTCATTTCCCTGA. Inner Left Sequence: TTTTCCACCAATATCCCCAA. Inner Right Sequence: TTGAAGCCCTTTTGTCAACC. Inner primer WT PCR product: 2810. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB871 |
C. elegans |
gly-13(ok712) X. Show Description
B0416.6. Homozygous. Outer Left Sequence: TGTTTCAAAACGCTCACTCG. Outer Right Sequence: TTCCATAACTGCAGTCGCAA. Inner Left Sequence: TTCGGTAAGAATGAAACCCG. Inner Right Sequence: TTCAAAACGGGAATCTGGAG. Inner primer WT PCR product: 3235. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB877 |
C. elegans |
nth-1(ok724) III. Show Description
R10E4.5. Homozygous. Outer Left Sequence: AGAATGCGGTAAAACGATGC. Outer Right Sequence: TGATGAATTGCATCCGAAAA. Inner Left Sequence: ACAGTGAATATGACGCGCAA. Inner Right Sequence: GCACACCTTCCTTTCTCTGC. Inner primer WT PCR product: 2170. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB880 |
C. elegans |
Y74C9A.4(ok727). Show Description
Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB881 |
C. elegans |
srp-9(ok728) V. Show Description
F09C6.5. Homozygous. Outer Left Sequence: TTCACCATCGGTTACGACAA. Outer Right Sequence: ATTATGGACTTGCGAGGTGC. Inner Left Sequence: GACTCGAGGACAGGGATCAA. Inner Right Sequence: CACCTACCTCTACCGCCAAA. Inner primer WT PCR product: 2731. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB883 |
C. elegans |
kqt-2(ok732) X. Show Description
M60.5. Homozygous. Outer Left Sequence: TCTTTGTCGGAGAAGCCACT. Outer Right Sequence: GCAAATTCAAAAGTTGGGGA. Inner Left Sequence: GAGAATGCCGGAAAATTCAA. Inner Right Sequence: TGGCAATAAAGTGACGCTTG. Inner primer WT PCR product: 3213. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB884 |
C. elegans |
fkh-10(ok733) I. Show Description
C25A1.2. Homozygous. Outer Left Sequence: ATTGAACCCCCTGAATTTCC. Outer Right Sequence: CAGGGCATCAAAAACTGACA. Inner Left Sequence: ATCTGTGTGCAGATGCTTGC. Inner Right Sequence: GGGAAAATGTTTTCAGCCAA. Inner primer WT PCR product: 2131. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB885 |
C. elegans |
Y76B12C.2(ok734) IV. Show Description
Y76B12C.2. Homozygous. Outer Left Sequence: ATTGGCAAAAGGTGAACGTC. Outer Right Sequence: CAGTTTCAAAGCATTTCGCA. Inner Left Sequence: CGGAAGATGAATGGGAAGAA. Inner Right Sequence: GACAAGCGACTCGTCTAGGG. Inner primer WT PCR product: 2715. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB886 |
C. elegans |
adr-2(ok735) III. Show Description
T20H4.4. Homozygous. Outer Left Sequence: CTCCATATTCGCTTCCGTGT. Outer Right Sequence: AGAACACGCTCTTCGTCGAT. Inner Left Sequence: CACGATGCTGCATGAGATTT. Inner Right Sequence: AGCTCGCTTCCAATCTTCAA. Inner primer WT PCR product: 2144. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB887 |
C. elegans |
C36H8.1(ok736) IV. Show Description
C36H8.1. Homozygous. Outer Left Sequence: GTGAAACCGATTTTGATGGG. Outer Right Sequence: GCGCGAGATGCTCTTTTATT. Inner Left Sequence: ATTTTGCACAACATAGGCCC. Inner Right Sequence: CCCTACTCGGATTCGTCAAA. Inner primer WT PCR product: 2103. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB888 |
C. elegans |
casy-1(ok739) II. Show Description
B0034.3. Homozygous. Outer Left Sequence: CCTTCGCGGTTTTTATTGAA. Outer Right Sequence: CCATCATTTGTGCAATACGC. Inner Left Sequence: AAAGAAGAAAATCGTGGCGA. Inner Right Sequence: ATTGCTCACATCGAGCCTCT. Inner primer WT PCR product: 2331. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB889 |
C. elegans |
ceh-40(ok740) X. Show Description
F17A2.5. Homozygous. Outer Left Sequence: AACAGTTGATGTTCCTCCCG. Outer Right Sequence: ACAATGGGCGAATAATCCA. Inner Left Sequence: GGGCCATCTGAAAATGAGAA. Inner Right Sequence: CCCACCTCTCGCTAATGTGT. Inner primer WT PCR product: 2509. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB893 |
C. elegans |
R09B5.4(ok746) V. Show Description
R09B5.4. Homozygous. Outer Left Sequence: AAAGCTTGGCAGAAAAACGA. Outer Right Sequence: TTCCATTTGATTGTGGGCTT. Inner Left Sequence: TTGTGACAATTTCCTGCCAA. Inner Right Sequence: TGAACTTCCTGCCCGTTATC. Inner primer WT PCR product: 2645. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB894 |
C. elegans |
pgp-13(ok747) X. Show Description
F22E10.2. Homozygous. Outer Left Sequence: GACAAAATGCAGGGTGGTTT. Outer Right Sequence: CGGGTAAGTTGCCAAGAAAA. Inner Left Sequence: CTGATTCCCGTCTCCACAAT. Inner Right Sequence: CTCAAGTGGCACGTCTTTCA. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB896 |
C. elegans |
gar-1(ok755). Show Description
C15B12.5 Homozygous. Outer Left Sequence: TGCAAATTTGAAAATGCCAA. Outer Right Sequence: CAAGTTCCGCACATCTCTGA. Inner Left Sequence: CGATTGGTAAAAGTTGGGGA. Inner Right Sequence: GTTTCCCTCGCCATATCAGA. Inner Primer WT PCR product: 3158. Deletion size: 1264 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
