Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB2215 C. elegans F40F9.2(ok2997) V. Show Description
F40F9.2 Homozygous. Outer Left Sequence: tcgctactttcccgcttaaa. Outer Right Sequence: tttcagtttgccatcacagc. Inner Left Sequence: tcgtaattatttgtgaaatgaaactt. Inner Right Sequence: cagaaccgtttcaggattgg. Inner Primer PCR Length: 1253. Deletion size: about 800bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2216 C. elegans K07C6.4(ok2998) V. Show Description
K07C6.4 Homozygous. Outer Left Sequence: aattctctgctcgtcggaaa. Outer Right Sequence: tcaatatgcacacagcgaca. Inner Left Sequence: tcgaggccgaagataaggat. Inner Right Sequence: gctttttaggctttctcgtgg. Inner Primer PCR Length: 1143. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2217 C. elegans R08C7.6(ok2999) IV. Show Description
R08C7.6 Homozygous. Outer Left Sequence: acggaacatttttcaaggca. Outer Right Sequence: accccaccaatcaacgataa. Inner Left Sequence: gcgacatttgcacaattaca. Inner Right Sequence: gagttggacgccactgattt. Inner Primer PCR Length: 1201. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2218 C. elegans jac-1(ok3000) IV. Show Description
Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2219 C. elegans C28C12.9(ok3004) IV. Show Description
C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2220 C. elegans R13H9.5(ok3005) IV. Show Description
R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2227 C. elegans K06H6.3(ok3012) V. Show Description
K06H6.3 Homozygous. Outer Left Sequence: gcaaatactgaacccgcaat. Outer Right Sequence: ccgacgaatttttcagcatt. Inner Left Sequence: ttttatttcggattgccagg. Inner Right Sequence: ttttcaaagtagacgccttcaa. Inner Primer PCR Length: 1395. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2230 C. elegans ZC395.10(ok3015) III. Show Description
ZC395.10 Homozygous. Outer Left Sequence: cttgcccatggaaactgatt. Outer Right Sequence: caatgccattcgcacttaaa. Inner Left Sequence: gaaaaacgaatgcgggataa. Inner Right Sequence: tcttgcttgttattgccgtg. Inner Primer PCR Length: 1195. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2231 C. elegans F47A4.1(ok3016) X. Show Description
F47A4.1 Homozygous. Outer Left Sequence: gcccgaagaagattaccaaa. Outer Right Sequence: acgacccaacgaacagaaac. Inner Left Sequence: tcctttcattcttttgctcaca. Inner Right Sequence: aagcggaaagtgtttctcctc. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2232 C. elegans grl-17(ok3017) V. Show Description
C56A3.1 Homozygous. Outer Left Sequence: tgattggcacatagtcggaa. Outer Right Sequence: ctacgttcaaagcggaggag. Inner Left Sequence: aaatgacagattgaagcggg. Inner Right Sequence: gaaaaacatggcaaccttcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2235 C. elegans cyp-35B1(ok3022) V. Show Description
K07C6.4. Homozygous. Outer Left Sequence: AATTCTCTGCTCGTCGGAAA. Outer Right Sequence: TCAATATGCACACAGCGACA. Inner Left Sequence: TCGAGGCCGAAGATAAGGAT. Inner Right Sequence: GCTTTTTAGGCTTTCTCGTGG. Inner Primer PCR Length: 1144 bp. Deletion Size: 480 bp. Deletion left flank: ATCTCTGGTTAGCTGGTCAAGATACCACTT. Deletion right flank: TTGGAAATCTTATCCTGCGATATGACATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2237 C. elegans tub-2(ok3024) I. Show Description
Y71G12A.3. Homozygous. Outer Left Sequence: AGGCGACTTCTCTCCCTCTC. Outer Right Sequence: TCATCATTATCGCCGATTCA. Inner Left Sequence: GTGTGTGTGTGTGTGTGCGT. Inner Right Sequence: TCCTTTCCACCAACGGATTA. Inner Primer PCR Length: 1267 bp. Deletion Size: 522 bp. Deletion left flank: GGTGTTAGGCTTTTCCACTGGAACTATTCA. Deletion right flank: TAAGCTGCCGATTCCACTCAAGGAGATGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2240 C. elegans sams-1(ok3033) X. Show Description
C49F5.1. Homozygous. Outer Left Sequence: AGGACTTGCGAGAGTACGGA. Outer Right Sequence: CTTGAGAGCTTTTGGCTGCT. Inner Left Sequence: AGTGAATCTGTGTCCGAGGG. Inner Right Sequence: GGGAACTCAGAGTGACCGAA. Inner Primer PCR Length: 1248 bp. Deletion Size: 480 bp. Deletion left flank: ACTCCGCGTTCACACTGTTGTGGTCTCTAC. Deletion right flank: TAGATAGGAGAAATTTCATTGGTTTTTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2242 C. elegans bbs-2(ok3035) IV. Show Description
F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2246 C. elegans T11F1.9(ok3040) II. Show Description
T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2247 C. elegans eat-17(ok3041) X. Show Description
T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2252 C. elegans nas-3(ok3046) V. Show Description
K06A4.1. Homozygous. Outer Left Sequence: CTTAAAGGTCGAAGCATGGC. Outer Right Sequence: TGTTGAAGCACAAAGATCGG. Inner Left Sequence: TTCACCCACTCCAACTTCTAA. Inner Right Sequence: CGGCGCTTTCTGAAATAAAA. Inner Primer PCR Length: 1162 bp. Deletion Size: 377 bp. Deletion left flank: CTCCGAACCACCAAAGGATGACGATATCGC. Deletion right flank: TGGCTCTTCGGAACTCGTGATGGAAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2255 C. elegans ZC395.10(ok3052) III. Show Description
ZC395.10. Homozygous. Outer Left Sequence: CTTGCCCATGGAAACTGATT. Outer Right Sequence: CAATGCCATTCGCACTTAAA. Inner Left Sequence: GAAAAACGAATGCGGGATAA. Inner Right Sequence: TCTTGCTTGTTATTGCCGTG. Inner Primer PCR Length: 1196 bp. Deletion Size: 816 bp. Deletion left flank: AAGAATTAAATTAGAGAAATTCAAATTGTA. Deletion right flank: ATTCGAAAAGAGAACTAGACGGATACGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2258 C. elegans F17A2.3(ok3059) X. Show Description
F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2259 C. elegans srh-16(ok3060) V. Show Description
F55C5.9 Homozygous. Outer Left Sequence: gcaggaaatgcattgtcaaa. Outer Right Sequence: cttcaagatgagccccaaaa. Inner Left Sequence: tctgattgtgataatcgccc. Inner Right Sequence: tccgtgaacgaatgtctgaa. Inner Primer PCR Length: 1173. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2260 C. elegans alfa-1(ok3062) II. Show Description
F18A1.6. Homozygous. Outer Left Sequence: GTCGAGACCGAACACCGTAT. Outer Right Sequence: CCACATACGATGCGCTTAAA. Inner Left Sequence: GGCAATATTTTGTGCCTGGT. Inner Right Sequence: TGCCGCTGTTAAAAGACTGA. Inner Primer PCR Length: 1259 bp. Deletion Size: 486 bp. Deletion left flank: GTCATCATTCCAAATGCATCTTCATACTTT. Deletion right flank: GTACTTGTTGTAGCAGATTCAGTCATATAT. Insertion Sequence: CAATCATCCATTGTCAATGTTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2262 C. elegans acr-10(ok3064) X. Show Description
R02E12.8. Homozygous. Outer Left Sequence: GACATTTGACGGTTCCGTTT. Outer Right Sequence: GCGAAATTGTGCATTTCTTG. Inner Left Sequence: CGATCCGTAACTTGGAAACAA. Inner Right Sequence: GAATTAGGAGCACACGACCA. Inner Primer PCR Length: 1151 bp. Deletion Size: 386 bp. Deletion left flank: TACTCAAGAAGATGCATAGGTTAGTCCAGC. Deletion right flank: CGCAATGGCTTTAGACAGATTATGCTTACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2263 C. elegans Y23B4A.2(ok3065) X. Show Description
Y23B4A.2. Homozygous. Outer Left Sequence: TCGGCATTCTGTTAGGAAGC. Outer Right Sequence: ACGGAACAGATCTCCTCGAA. Inner Left Sequence: GACCGTAATCCCGTTCACAA. Inner Right Sequence: TGTATTTTGGTAACGCGTCG. Inner Primer PCR Length: 1292 bp. Deletion Size: 598 bp. Deletion left flank: TTCCTTTTCTGTCTTTTATTAATTTCCTTT. Deletion right flank: AAAATTTTGTTTTTCAGTAACAATTCCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2267 C. elegans prk-2(ok3069) III. Show Description
F45H7.4. Homozygous. Outer Left Sequence: ACGCACGAATCATGTTCAAA. Outer Right Sequence: ACCGAGCATACTGGCTTGTT. Inner Left Sequence: TCTTACCGTATTCGAAGAACTCG. Inner Right Sequence: CTGATTGTGGGTTTCAAGCA. Inner Primer PCR Length: 1347 bp. Deletion Size: 617 bp. Deletion left flank: GAGTTTTGTGGAGCCGGTGACCAAGTCGAT. Deletion right flank: ATGAGCCTTAAATTTAAGCACAAAAATATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2269 C. elegans R09A1.5(ok3071) V. Show Description
R09A1.5. Homozygous. Outer Left Sequence: CCGTAATCGTTCCGCATTAT. Outer Right Sequence: GCCGAAATGGGACACTCTAA. Inner Left Sequence: CCAGGGAGTCTCTGTTCAGC. Inner Right Sequence: CTGTAGCAATAGTTTCAGCTGTG. Inner Primer PCR Length: 1333 bp. Deletion Size: 610 bp. Deletion left flank: CGGGCTATAGGCCTAGGCCAGGCTATAGGT. Deletion right flank: GTTCCTCGATGCACCATATCTTACGCGCAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2270 C. elegans nas-7(ok3080) II. Show Description
C07D10.4. Homozygous. Outer Left Sequence: AAATGTGTTACGGTGTGCGA. Outer Right Sequence: TCGCATTCGCATAGTTTCAG. Inner Left Sequence: CTCACATTTGACTTTCGGCA. Inner Right Sequence: CTTCTCCATGCTTTTGCCAT. Inner Primer PCR Length: 1205 bp. Deletion Size: 760 bp. Deletion left flank: TAATTGTTGCATATTCCATACATCCATTAT. Deletion right flank: TTAATGAATCTGTGCTATCTGATATAACAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2271 C. elegans Y106G6H.14(ok3081) I. Show Description
Y106G6H.14. Homozygous. Outer Left Sequence: CAGCATCCGAGTCTGACAAA. Outer Right Sequence: GACCGTCTTCGTCCATCATT. Inner Left Sequence: TTCAGCATACTCTTCTTCATTCAC. Inner Right Sequence: GCGGACCGTTGACTTTCTAT. Inner Primer PCR Length: 1296 bp. Deletion Size: 333 bp. Deletion left flank: TCAACAACGTATCCACTGCTGGCGCGTGTC. Deletion right flank: TAAAAACTGTAAAACCATGTGAATTAATCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2273 C. elegans C49D10.10(ok3083) II. Show Description
C49D10.10. Homozygous. Outer Left Sequence: TTTGAAATCCACACTTGGCA. Outer Right Sequence: TTTTGGCGGGAGAGAATAAA. Inner Left Sequence: AGCTCCGCAAATGACAATTC. Inner Right Sequence: TTCTCCGTTTCAAGATTTAGCA. Inner Primer PCR Length: 1256 bp. Deletion Size: 248 bp. Deletion left flank: TCAGTAGGATAATCAGATGTGATCTGAAAA. Deletion right flank: GAGCAGGTTTAATTTCCACAAATGCATCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2274 C. elegans clec-106&Y18D10A.23(ok3084) I. Show Description
Y18D10A.12, Y18D10A.23. Homozygous. Outer Left Sequence: ACCACGACTGGGAAGTTCAG. Outer Right Sequence: GCCTAACATCTGCCTTCTCG. Inner Left Sequence: ACTGGATTCTAGGCCCACG. Inner Right Sequence: GTTGCTCCATGCTACGTGAA. Inner Primer PCR Length: 1318 bp. Deletion Size: 719 bp. Deletion left flank: TTCTTCCGCCAACCCATACCTCGGCTGTTC. Deletion right flank: AATGCTCCGCAACAATGCAACGATCCACCC. Insertion Sequence: GCTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2275 C. elegans flp-16(ok3085) II. Show Description
F15D4.8. Homozygous. Outer Left Sequence: TTTTCGAAGCCTGTTAGCGT. Outer Right Sequence: TTTAAGTTTCCACAGGCGCT. Inner Left Sequence: AAAGTCCTGAAAAAGAAGCAGC. Inner Right Sequence: TTGAAAACAACGGTCTCGAA. Inner Primer PCR Length: 1201 bp. Deletion Size: 548 bp. Deletion left flank: CCTAAATTTGATGAATGAGTGTGGATCCGA. Deletion right flank: CCTATAGGCATCATCCATCAAAACCCCACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2277 C. elegans ser-5(ok3087) I. Show Description
F16D3.7. Homozygous. Outer Left Sequence: GGATAAGTACGGGCAACGAA. Outer Right Sequence: AATGCGGAACGTTTGAACTC. Inner Left Sequence: TGGAGAACAATTACCCCCTG. Inner Right Sequence: AGATGATGGGATTGAGCATTG. Inner Primer PCR Length: 1119 bp. Deletion Size: 410 bp. Deletion left flank: ATTGTCACGAAAACAAAAGTAATATCAGTG. Deletion right flank: GAAAGACAAACGGGATGGTGGAGCATCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2281 C. elegans lrx-1(ok3104) V. Show Description
T04H1.6. Homozygous. Outer Left Sequence: TGGAGGCTACGTTCCAAATC. Outer Right Sequence: TGAGAAGAAGGGAGGCAGAA. Inner Left Sequence: CTGTTCAGCAGCCATATCCA. Inner Right Sequence: CCACACATGAAACACCTCCA. Inner Primer PCR Length: 1313 bp. Deletion Size: 432 bp. Deletion left flank: AAGCTATTTTTATTTGTATGCTATCAATAT. Deletion right flank: GCCTCAATCCTGTATCCATGTGAGCAAACG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2282 C. elegans Y106G6E.4(ok3105) I. Show Description
Y106G6E.4 Homozygous. Outer Left Sequence: cacctcggaaggctagaatg. Outer Right Sequence: ccgatccctgacgatatcaa. Inner Left Sequence: tcacaaaaccatttgaggaatg. Inner Right Sequence: ggcaaaacatttccatgtgc. Inner Primer PCR Length: 1244. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2287 C. elegans C09E8.2(ok3110) II. Show Description
C09E8.2 Homozygous. Outer Left Sequence: tcttctggagcagggcttta. Outer Right Sequence: ccgttgcggaaatttttagt. Inner Left Sequence: tgaacaaagttatggtactttggaa. Inner Right Sequence: tgacaacttaccccgtttttc. Inner Primer PCR Length: 1219. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2291 C. elegans PDB1.1(ok3114) X. Show Description
PDB1.1 Homozygous. Outer Left Sequence: tgtgttcgtttcagtctcgc. Outer Right Sequence: atgaaaaccaaaatgcgctc. Inner Left Sequence: acggaatatgctccctgatg. Inner Right Sequence: gcccacaaagaagatatgcaa. Inner Primer PCR Length: 1113. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2294 C. elegans acr-6(ok3117) I. Show Description
ZK973.5 Homozygous. Outer Left Sequence: cagcgtgagtcatagccaaa. Outer Right Sequence: aattgagtttggcaaatcgg. Inner Left Sequence: cgttcccatctggtgagttc. Inner Right Sequence: ccgatttgccgaattgttta. Inner Primer PCR Length: 1131. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2299 C. elegans Y18D10A.12(ok3122) I. Show Description
Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2300 C. elegans Y18D10A.12(ok3123) I. Show Description
Y18D10A.12 Homozygous. Outer Left Sequence: accacgactgggaagttcag. Outer Right Sequence: gcctaacatctgccttctcg. Inner Left Sequence: actggattctaggcccacg. Inner Right Sequence: gttgctccatgctacgtgaa. Inner Primer PCR Length: 1317. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2302 C. elegans daf-7(ok3125) III. Show Description
B0412.2 Homozygous. Maintain at 15C. Outer Left Sequence: cttccttctttccctcccac. Outer Right Sequence: ttgtgacaatcggaagtgga. Inner Left Sequence: gcttatccggatttgacgaa. Inner Right Sequence: catttcttggcgatcattcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2305 C. elegans F20D1.1(ok3128) X. Show Description
F20D1.1 Homozygous. Outer Left Sequence: tgcacaactcggaaatgaaa. Outer Right Sequence: aatccaaagcttatcgcgtg. Inner Left Sequence: gcttaagtgagaggaggggg. Inner Right Sequence: gcaattctcaacggttttctc. Inner Primer PCR Length: 1207. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2306 C. elegans Y105C5A.1(ok3129) IV. Show Description
Y105C5A.1 Homozygous. Outer Left Sequence: cgctttctcctgtaactgcc. Outer Right Sequence: cgtcctgctccaacacctat. Inner Left Sequence: cgtcgtcttcttatcctgcaa. Inner Right Sequence: atggaagagcaaaagccaaa. Inner Primer PCR Length: 1224. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2307 C. elegans D2023.6(ok3130) V. Show Description
D2023.6 Homozygous. Outer Left Sequence: tgtcaacggaggtgttttca. Outer Right Sequence: actatctgaacggcgaatgg. Inner Left Sequence: aacacatttcgggaatggaa. Inner Right Sequence: aaaaacggcagaaagaccaa. Inner Primer PCR Length: 1204. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2311 C. elegans R03G8.6(ok3143) X. Show Description
R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2312 C. elegans F40B5.1(ok3144) X. Show Description
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2313 C. elegans F40B5.1(ok3145) X. Show Description
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2316 C. elegans str-2(ok3148) V. Show Description
C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2318 C. elegans Y43F8B.2(ok3150) V. Show Description
Y43F8B.2 Homozygous. Outer Left Sequence: tcacaacccggtgactgata. Outer Right Sequence: ctgtgacctttcggaccatt. Inner Left Sequence: gggtcaatagctggtgtgct. Inner Right Sequence: cacttctcctgttccccaaa. Inner Primer PCR Length: 1176. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2321 C. elegans K02F3.6(ok3153) III. Show Description
K02F3.6 Homozygous. Outer Left Sequence: aattttgaaatttgccgcac. Outer Right Sequence: gttcaacgatgcgagatcaa. Inner Left Sequence: gttcaacgatgcgagatcaa. Inner Right Sequence: tatccatttcaacgagggga. Inner Primer PCR Length: 1282. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2330 C. elegans PDB1.1(ok3166) X. Show Description
PDB1.1. Homozygous. Outer Left Sequence: TGTGTTCGTTTCAGTCTCGC. Outer Right Sequence: ATGAAAACCAAAATGCGCTC. Inner Left Sequence: ACGGAATATGCTCCCTGATG. Inner Right Sequence: GCCCACAAAGAAGATATGCAA. Inner Primer PCR Length: 1114 bp. Deletion Size: 343 bp. Deletion left flank: TTCGCTGAAATATCATTCATTTAGAATGTA. Deletion right flank: GATGTTACCGTAAACGCGCTATCAGAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2331 C. elegans bre-4(ok3167) I. Show Description
Y73E7A.7. Homozygous. Outer Left Sequence: CTCTGTCCCCCATTTTCTCA. Outer Right Sequence: TTCCATATTCGGCGATCTTC. Inner Left Sequence: AGAACCCTCCGAAAAATCGT. Inner Right Sequence: CGGAATCAGTGCACTAACAAA. Inner Primer PCR Length: 1315 bp. Deletion Size: 496 bp. Deletion left flank: TTTTTTTCAAAAATCAATAAAAGTCATCGA. Deletion right flank: AATCATTTTATATCGTGCAATTTGTGTCGG. Insertion Sequence: AGTCATCGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807